Previous Contig 003709:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS008B03Sequence620003709 (27)sp|P31542|CLAB_LYCES9e-50ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS011B11Sequence594003709 (27)sp|P31542|CLAB_LYCES6e-53ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS013F06Sequence607003709 (27)sp|P31542|CLAB_LYCES2e-46ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS020A03Sequence374003709 (27)sp|P31542|CLAB_LYCES7e-15ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS020E04Sequence374003709 (27)sp|P31542|CLAB_LYCES7e-15ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS021F09Sequence606003709 (27)sp|P31542|CLAB_LYCES6e-53ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS028A07Sequence443003709 (27)sp|P31542|CLAB_LYCES5e-41ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS047F11Sequence607003709 (27)sp|P31542|CLAB_LYCES5e-74ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS050C06Sequence576003709 (27)sp|P31542|CLAB_LYCES4e-42ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS063F02Sequence582003709 (27)sp|P31542|CLAB_LYCES7e-49ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS085D06Sequence611003709 (27)sp|P31542|CLAB_LYCES3e-48ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS090D12Sequence612003709 (27)sp|P31542|CLAB_LYCES6e-88ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS093C07Sequence606003709 (27)sp|P31542|CLAB_LYCES6e-53ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS094C05Sequence609003709 (27)sp|P31542|CLAB_LYCES8e-45ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS096D08Sequence598003709 (27)sp|P31542|CLAB_LYCES2e-53ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS097F10Sequence619003709 (27)sp|P31542|CLAB_LYCES4e-60ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS102G06Sequence616003709 (27)sp|P31542|CLAB_LYCES1e-57ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS103C03Sequence580003709 (27)sp|P31542|CLAB_LYCES2e-35ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS114B11Sequence542003709 (27)sp|P31542|CLAB_LYCES2e-45ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS123D07Sequence569003709 (27)sp|P31542|CLAB_LYCES2e-44ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS124F04Sequence567003709 (27)sp|P31542|CLAB_LYCES2e-36ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS153H04Sequence606003709 (27)sp|P31542|CLAB_LYCES6e-53ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS156E12Sequence626003709 (27)sp|P31542|CLAB_LYCES1e-56ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS156H12Sequence601003709 (27)sp|P31542|CLAB_LYCES2e-85ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS158H09Sequence486003709 (27)sp|P31542|CLAB_LYCES2e-28ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS161E04Sequence466003709 (27)sp|P31542|CLAB_LYCES2e-38ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr
JMFS167E11Sequence559003709 (27)sp|P31542|CLAB_LYCES2e-48ATP-dependent Clp protease ATP-binding subunit clpA homolog CD4B, chloroplast pr

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS090D12+ GCATCAATTGCCCCTTCCGCTGCTCCAGCACCAATCAA
JMFS156H12+ CCAGCACCAATCAA
                      ____________________________________________________________
consensus GCATCAATTGCCCCTTCCGCTGCTCCAGCACCAATCAA
 
. : . : . : . : . : . :
JMFS090D12+ TGTGTGTACTTCATCAATAAACAGTATAATCTCATCACTCTGTTTAATTTCTTCCATCAG
JMFS156H12+ TGTGTGTACTTCATCAATAAACAGTATAATCTCATCACTCTGTTTAATTTCTTCCATCAG
                      ____________________________________________________________
consensus TGTGTGTACTTCATCAATAAACAGTATAATCTCATCACTCTGTTTAATTTCTTCCATCAG
 
. : . : . : . : . : . :
JMFS090D12+ CTTCTTTAGCCTCTCCTCAAACTCTCCACGATATTTTGTCCCAGCAACAAGAAGACCCAT
JMFS156H12+ CTTCTTTAGCCTCTCCTCAAACTCTCCACGATATTTTGTCCCAGCAACAAGAAGACCCAT
                      ____________________________________________________________
consensus CTTCTTTAGCCTCTCCTCAAACTCTCCACGATATTTTGTCCCAGCAACAAGAAGACCCAT
 
. : . : . : . : . : . :
JMFS090D12+ ATCCAGGGTAATAACCTTCTTTCCCTCAATTGTTTCAGGAACATCACCATTAGCAATTCG
JMFS156H12+ ATCCAGGGTAATAACCTTCTTTCCCTCAATTGTTTCAGGAACATCACCATTAGCAATTCG
                      ____________________________________________________________
consensus ATCCAGGGTAATAACCTTCTTTCCCTCAATTGTTTCAGGAACATCACCATTAGCAATTCG
 
. : . : . : . : . : . :
JMFS090D12+ TTGAGCTAAGCCTTCAGCAATAGCCGTTTTCCCAACACCTGGTTCTCCAATAAGGCAAGG
JMFS156H12+ TTGAGCTAAGCCTTCAGCAATAGCCGTTTTCCCAACACCTGGTTCTCCAATAAGGCAAGG
JMFS047F11+ CCAATAAGGCAAGG
                      ____________________________________________________________
consensus TTGAGCTAAGCCTTCAGCAATAGCCGTTTTCCCAACACCTGGTTCTCCAATAAGGCAAGG
 
. : . : . : . : . : . :
JMFS090D12+ ATTGTTCTTTGTACGCCGACCCAAAATTTGAGTTACCCGCTCAATTTGATCCTGCCTTCC
JMFS156H12+ ATTGTTCTTTGTACGCCGACCCAAAATTTGAGTTACCCGCTCAATTTGATCCTGCCTTCC
JMFS047F11+ ATTGTTCTTTGTACGCCGACCCAAAATNTGAGTTACCCGCTCAATTTGATCCTGCCTTCC
                      ____________________________________________________________
consensus ATTGTTCTTTGTACGCCGACCCAAAATTTGAGTTACCCGCTCAATTTGATCCTGCCTTCC
 
. : . : . : . : . : . :
JMFS090D12+ AACTACAGGATCCAGTTTTCCCTCCTCAGCTAACTTTGTCAAATTGGTACCATACTCCTC
JMFS156H12+ AACTACAGGATCCAGTTTTCCCTCCTCAGCTAACTTTGTCAAATTGGTACCATACTCCTC
JMFS047F11+ AACTACAGGATCCAGTTTTCCCTCCTCAGCTAACTTTGTCAAATTGGTACCATACTCCTC
                      ____________________________________________________________
consensus AACTACAGGATCCAGTTTTCCCTCCTCAGCTAACTTTGTCAAATTGGTACCATACTCCTC
 
. : . : . : . : . : . :
JMFS090D12+ TAATGTCGGCATCTTTTGTCCTGAAGTTCCACCTCCAACAGCAGCACCAACAGCTTCAGC
JMFS156H12+ TAATGTCGGCATCTTTTGTCCTGAAGTTCCACCTCCAACAGCAGCACCAACAGCTTCAGC
JMFS047F11+ TAATGTCGGCATCTTTTGTCCTGAAGTTCCACCTCCAACAGCAGCACCAACAGCTTCAGC
                      ____________________________________________________________
consensus TAATGTCGGCATCTTTTGTCCTGAAGTTCCACCTCCAACAGCAGCACCAACAGCTTCAGC
 
. : . : . : . : . : . :
JMFS090D12+ ACTCTCACCAACCATTCGGATGACCTGTGTTCTAATGTTACTTGGGTCAGCACCCAAGTT
JMFS156H12+ ACTCTCACCAACCATTCGGATGACCTGTGTTCTAATGTTACTTGGGTCAGCACCCAAGTT
JMFS047F11+ ACTCTCACCAACCATTCGGATGACCTGTGTTCTAATGTTACTTGGGTCAGCACCCAAGTT
                      ____________________________________________________________
consensus ACTCTCACCAACCATTCGGATGACCTGTGTTCTAATGTTACTTGGGTCAGCACCCAAGTT
 
. : . : . : . : . : . :
JMFS090D12+ TTCAAGAACACGAGCAGCCACTCCTTCACCCTCTCGAAGCAATCCAAGAAGCAAGTGCTC
JMFS156H12+ TTCAAGAACACGAGCAGCCACTCCTTCACCCTCTCGAAGCAATCCAAGAAGCAAGTGCTC
JMFS047F11+ TTCAAGAACACGAGCAGCCACTCCTTCACCCTCTCGAAGCAATCCAAGAAGCAAGTGCTC
                      ____________________________________________________________
consensus TTCAAGAACACGAGCAGCCACTCCTTCACCCTCTCGAAGCAATCCAAGAAGCAAGTGCTC
 
. : . : . : . : . : . :
JMFS090D12+ TGACCCAATATAGTTATGCCCTAGTTGACGGGCT
JMFS156H12+ TGACCCAATATAGTTATGCCCTAGTTGACGGGCTTCCTCTAAAGAGA
JMFS047F11+ TGACCCAATATAGTTATGCCCTAGTTGACGGGCTTCCTCTAAAGAGAGTTCCAACACACG
JMFS102G06+ TTATGCCCTAGTTGACGGGCTTCCTCTAAAGAGAGTTCCAACACACG
JMFS097F10+ TTATGCCCTAGTTGACGGGCTTCCTCTANAGAGAGTTCCAACACACG
JMFS096D08+ GAGTTCCAACACACG
JMFS028A07+ ACG
JMFS011B11+ AGTTCCAACACACG
JMFS156E12+ AGTTGACGGGCTTCCTCTAAAGAGAGTTCCAACACACG
JMFS153H04+ AGTTCCAACACACG
JMFS093C07+ AGTTCCAACACACG
JMFS021F09+ AGTTCCAACACACG
JMFS085D06+ AGTTCCAACACACG
JMFS013F06+ CACG
                      ____________________________________________________________
consensus TGACCCAATATAGTTATGCCCTAGTTGACGGGCTTCCTCTAAAGAGAGTTCCAACACACG
 
. : . : . : . : . : . :
JMFS047F11+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS102G06+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS097F10+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS096D08+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS028A07+ CTTTGCACGGGAAGTAAACGGAATCTCAACAGCAAGGAAGCCACTGCCCCTTCCAATTAT
JMFS011B11+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS156E12+ CTNTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS153H04+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS093C07+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS063F02+ CACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTCCAAATTAT
JMFS021F09+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS085D06+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS013F06+ CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAA-TAT
JMFS050C06+ GCCCCTTCCAATTAT
JMFS123D07+ TCAACAGCATCGAAGCCACTGCCCCTTCCAATTAT
JMFS167E11+ AGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS114B11+ CAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS161E04+ ACTGCCCCTTCCAATTAT
JMFS008B03+ ACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
JMFS094C05+ ACAGCAACGAAGCCACTGCCCCTTCCAATTAT
                      ____________________________________________________________
consensus CTTTGCACGGGGAGTAAACGGAATCTCAACAGCAACGAAGCCACTGCCCCTTCCAATTAT
 
. : . : . : . : . : . :
JMFS047F11+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS102G06+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS097F10+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS096D08+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS028A07+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS011B11+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS156E12+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS153H04+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS093C07+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS063F02+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS021F09+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS085D06+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS013F06+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS050C06+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS123D07+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS167E11+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS114B11+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS158H09+ CTTAGC
JMFS161E04+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS008B03+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS094C05+ CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS124F04+ ACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
JMFS103C03+ CATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
                      ____________________________________________________________
consensus CTTCTCCACCTCCACACGAGCATCTTTTAAATTGATTCCCATGGATTTAAGAACCTTAGC
 
. : . : . : . : . : . :
JMFS047F11+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS102G06+ AGCAATTCCAGATCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAAC-AAATT
JMFS097F10+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS096D08+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS028A07+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS011B11+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS156E12+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS153H04+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS093C07+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS063F02+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS021F09+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS085D06+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS013F06+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS050C06+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS123D07+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS167E11+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS114B11+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS158H09+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS161E04+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS008B03+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS094C05+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS124F04+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
JMFS103C03+ AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
                      ____________________________________________________________
consensus AGCAATTCCAGTTCCCTCACCAATAAGACCCAATAGAATTTGTTCAGTGCCAACAAAATT
 
. : . : . : . : . : . :
JMFS047F11+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTT
JMFS102G06+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS097F10+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS096D08+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS028A07+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS011B11+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS156E12+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS153H04+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS093C07+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS063F02+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS021F09+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS085D06+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS013F06+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS050C06+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS123D07+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS167E11+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS114B11+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS158H09+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS161E04+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS008B03+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS094C05+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS124F04+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
JMFS103C03+ GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
                      ____________________________________________________________
consensus GTGGCCAAGACGTCTTGCCTCCTCTTGGGCAAGCATAATGACTTTTATTGCTTTCTCAGT
 
. : . : . : . : . : . :
JMFS102G06+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS097F10+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS096D08+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS028A07+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS011B11+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS156E12+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS153H04+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS093C07+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS063F02+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS021F09+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS085D06+ GAAGCGCTCAA--ATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS013F06+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS050C06+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS123D07+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS167E11+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS114B11+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS158H09+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS161E04+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS020E04+ AAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS020A03+ AAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS008B03+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS094C05+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS124F04+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
JMFS103C03+ GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
                      ____________________________________________________________
consensus GAAGCGCTCAAACATAGCTTTAACAACAGCACGGCTACCTCTCCCTCGTCTACCAGAAGT
 
. : . : . : . : . : . :
JMFS102G06+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS097F10+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS096D08+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS028A07+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS011B11+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS156E12+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS153H04+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS093C07+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS063F02+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS021F09+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS085D06+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS013F06+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS050C06+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS123D07+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS167E11+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS114B11+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS158H09+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAAAGTGCCATTGTATCTAAGGCATT
JMFS161E04+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS020E04+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS020A03+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS008B03+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS094C05+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS124F04+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
JMFS103C03+ TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
                      ____________________________________________________________
consensus TGCAGCAGCTACCTTAGAATGAAGTGTTTGCCCAGAACGTGCCATTGTATCTAAGGCATT
 
. : . : . : . : . : . :
JMFS102G06+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS097F10+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS096D08+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS028A07+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGT-AACT-CAAAG
JMFS011B11+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS156E12+ GGCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS153H04+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS093C07+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS063F02+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS021F09+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS085D06+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS013F06+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS050C06+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS123D07+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS167E11+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS114B11+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS158H09+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAC
JMFS161E04+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS020E04+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS020A03+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS008B03+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS094C05+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS124F04+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
JMFS103C03+ GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
                      ____________________________________________________________
consensus GCCACCACGCAATCCAGTAAAACTTCTCAACTTCAAAGAAGGTGACTGTGAACTACAAAG
 
. : . : . : . : . : . :
JMFS102G06+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS097F10+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS096D08+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS028A07+ CATTGCAAC-ACCCTTTTTCCTT
JMFS011B11+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS156E12+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS153H04+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS093C07+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS063F02+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS021F09+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS085D06+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS013F06+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS050C06+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS123D07+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS167E11+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS114B11+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS158H09+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS161E04+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS020E04+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS020A03+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS008B03+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS094C05+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS124F04+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
JMFS103C03+ CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
                      ____________________________________________________________
consensus CATTGCAACTACCCTTTTTCCTTTTCCTTTTCCTTTTCCAGATCCCTTGAATTGTCCAAT
 
. : . : . : . : . : . :
JMFS102G06+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS097F10+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS096D08+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS011B11+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS156E12+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS153H04+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS093C07+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS063F02+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS021F09+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS085D06+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS013F06+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS050C06+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS123D07+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS167E11+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS114B11+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS158H09+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS161E04+ TGCTTCACCAGCAACCAAAGAAGGGATG
JMFS020E04+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS020A03+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS008B03+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS094C05+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS124F04+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
JMFS103C03+ TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
                      ____________________________________________________________
consensus TGCTTCACCAGCAACCAAAGAAGGGATGTTAGTTGACTGAACTAAAACCCTAGCCATGAT
 
. : . : . : . : . : . :
JMFS102G06+ GCCTCCAAGAGATCCGGATCACAATAT
JMFS097F10+ GCCTCCAAGAGATCCGGATCACAATATG
JMFS096D08+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAG
JMFS011B11+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGA
JMFS156E12+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAA
JMFS153H04+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAA
JMFS093C07+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAA
JMFS063F02+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAA
JMFS021F09+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAA
JMFS085D06+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAG
JMFS013F06+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
JMFS050C06+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
JMFS123D07+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGA
JMFS167E11+ GCCTCCAAGAGATCCGGATCACAATATGAAA
JMFS114B11+ GCCTCCAAGAGATCCGGATCACAATATG
JMFS158H09+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
JMFS020E04+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
JMFS020A03+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
JMFS008B03+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
JMFS094C05+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
JMFS124F04+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
JMFS103C03+ GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
                      ____________________________________________________________
consensus GCCTCCAAGAGATCCGGATCACAATATGAAAAAATCAGGAGAGAGAAAGAAAGAGAGAGA
 
. : . : . : . : . : . :
JMFS013F06+ GAGA
JMFS050C06+ GAGAGCGAGCGAAGGGGAAAA
JMFS020E04+ GAGAGCGAGCGAAGGGGAAAAGA
JMFS020A03+ GAGAGCGAGCGAAGGGGAAAAGA
JMFS008B03+ GAGAGCGAGCGAAGGGGAAAAGAGGA
JMFS094C05+ GAGAGCGAGCGAAGGGGAAAAGAGGAGAGGGGAAGGA
JMFS124F04+ GAGAGCGAGCGAAGGGGAAAAGAGGAGAGGGGAAGGA
JMFS103C03+ GAGAGCGAGCGAAGGGGAAAAGAGGAGAGGGGAAGGATAATATGGAAGATAGAGAGATGA
                      ____________________________________________________________
consensus GAGAGCGAGCGAAGGGGAAAAGAGGAGAGGGGAAGGATAATATGGAAGATAGAGAGATGA