Previous Contig 003707:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026N01Sequence274003707 (2)
JMFS103B01Sequence601003707 (2)gb:AF370145_17920333e-05Arabidopsis thaliana unknown protein (At1g27200) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS103B01+ G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMFS103B01+ GGTGGAACAGGGCATCTCACAATCACCCTAGACTCATCATAATCATCCACAGACAAAACA
                      ____________________________________________________________
consensus GGTGGAACAGGGCATCTCACAATCACCCTAGACTCATCATAATCATCCACAGACAAAACA
 
. : . : . : . : . : . :
JMFS103B01+ TTCTCTTCTTCTTTAGTACCCTTATCCACACTGTTGTAATAAACACACTCCAATTCTGTA
                      ____________________________________________________________
consensus TTCTCTTCTTCTTTAGTACCCTTATCCACACTGTTGTAATAAACACACTCCAATTCTGTA
 
. : . : . : . : . : . :
JMFS103B01+ CCCAAAACCCCATTTTTCCTAGCCAACACCAAAACATGATCCGGGAACAAAACCCGGCCC
                      ____________________________________________________________
consensus CCCAAAACCCCATTTTTCCTAGCCAACACCAAAACATGATCCGGGAACAAAACCCGGCCC
 
. : . : . : . : . : . :
JMFF026N01+ TCTCGAAACGAAGAAGAAGAAGAGGAG
JMFS103B01+ TCTATTTTCACCGGCAACAGAAAACGGCTGAAATCTCGAAACGAAGAAGAAGAAGAGGAG
                      ____________________________________________________________
consensus TCTATTTTCACCGGCAACAGAAAACGGCTGAAATCTCGAAACGAAGAAGAAGAAGAGGAG
 
. : . : . : . : . : . :
JMFF026N01+ GAGGAAGAAGAAGAGGACATCAAAGAAAAGCTTGAAACTNCGAGTACGGGTCGGAAAGCG
JMFS103B01+ GAGGAAGAAGAAGAGGACATCAAAGAAAAGCTTGAAACTACGAGTACGGGTCGGAAAGCG
                      ____________________________________________________________
consensus GAGGAAGAAGAAGAGGACATCAAAGAAAAGCTTGAAACTACGAGTACGGGTCGGAAAGCG
 
. : . : . : . : . : . :
JMFF026N01+ GAGGAATTGATGATGGGGATTTTGAAGGAGAGGAGATAAAGAAAGAGCAAGAAGGAGAAG
JMFS103B01+ GAGGAATTGATGATGGGGATTTTGAAGGAGAGGAGATAAAGAAAGAGCAAGAAGGAGAAG
                      ____________________________________________________________
consensus GAGGAATTGATGATGGGGATTTTGAAGGAGAGGAGATAAAGAAAGAGCAAGAAGGAGAAG
 
. : . : . : . : . : . :
JMFF026N01+ CACAAGAGGAAAGACCNTAGGGAGAGGAAATGGAGGAGTGGAGAAGAAGAAGACGACGGC
JMFS103B01+ CACAAGAGGAAAGACCTTAGGGAGAGGAAATGGAGGAGTGGAGAAGAAGAAGACGACGGC
                      ____________________________________________________________
consensus CACAAGAGGAAAGACCTTAGGGAGAGGAAATGGAGGAGTGGAGAAGAAGAAGACGACGGC
 
. : . : . : . : . : . :
JMFF026N01+ GTCGATAGCCGGAGAAGACGTTTTCGCTTGCGGCGTTGCTCTGAAGAATCCATTTTGTNG
JMFS103B01+ GTCGATAGCCGGAGAAGACGTTTTCGCTTGCGGCGTTGCTCTGAAGAATCCATTTTGTTG
                      ____________________________________________________________
consensus GTCGATAGCCGGAGAAGACGTTTTCGCTTGCGGCGTTGCTCTGAAGAATCCATTTTGTTG
 
. : . : . : . : . : . :
JMFF026N01+ GAACAAC
JMFS103B01+ GAACAACGGTTTGGATCCCCTCCAAGAAGAAAGGGTTTTGAAGTTGGGTTGCGTAGATCT
                      ____________________________________________________________
consensus GAACAACGGTTTGGATCCCCTCCAAGAAGAAAGGGTTTTGAAGTTGGGTTGCGTAGATCT
 
. : . : . : . : . : . :
JMFS103B01+ GAAGGCAAGACGGAGGGAGGTTTTCTTGGACGGTGGTGGTTCTGCGTAATCCGGCAAGTG
                      ____________________________________________________________
consensus GAAGGCAAGACGGAGGGAGGTTTTCTTGGACGGTGGTGGTTCTGCGTAATCCGGCAAGTG