Previous Contig 003705:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS102H11Sequence611003705 (3)gb:AY065457_15665625e-08Arabidopsis thaliana putative protein kinase (At2g28250) mRNA, complete cds.>gb:
JMFS103A05Sequence580003705 (3)gb:AY065457_15665624e-08Arabidopsis thaliana putative protein kinase (At2g28250) mRNA, complete cds.>gb:
JMSF040B05Sequence679003705 (3)gb:AY065457_15665623e-26Arabidopsis thaliana putative protein kinase (At2g28250) mRNA, complete cds.>gb:

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040B05+ CATTTTGCTTCTGAATAGTA
                      ____________________________________________________________
consensus CATTTTGCTTCTGAATAGTA
 
. : . : . : . : . : . :
JMSF040B05+ ATGACGCCTNGGGAATGCACCCTCTAACAAAATTTGTTGGGGTGGCTGCAGAAACTTTAG
                      ____________________________________________________________
consensus ATGACGCCTNGGGAATGCACCCTCTAACAAAATTTGTTGGGGTGGCTGCAGAAACTTTAG
 
. : . : . : . : . : . :
JMSF040B05+ ATTCTGTTTCTGAAGAAGCTCCTTGGCTTATTAAGTTAGTAGCACTACTGAAACTTGTTT
                      ____________________________________________________________
consensus ATTCTGTTTCTGAAGAAGCTCCTTGGCTTATTAAGTTAGTAGCACTACTGAAACTTGTTT
 
. : . : . : . : . : . :
JMSF040B05+ CTTTATCTGGTGAAAAAATATGTCGTTGAACAGAATATTTATCCCTTTGATAGATGTAGC
                      ____________________________________________________________
consensus CTTTATCTGGTGAAAAAATATGTCGTTGAACAGAATATTTATCCCTTTGATAGATGTAGC
 
. : . : . : . : . : . :
JMSF040B05+ ACAGCATCAAAGCAATAAATGCAAGAGTTGCAACTGCTGAACAAAGTAAGAGAATAACAA
                      ____________________________________________________________
consensus ACAGCATCAAAGCAATAAATGCAAGAGTTGCAACTGCTGAACAAAGTAAGAGAATAACAA
 
. : . : . : . : . : . :
JMSF040B05+ AAACAGCTTTGCTGGAAATCCACTTCTTGGGATACTGTGTTTCAACTGGAGTCCCAAAAC
JMFS103A05+ CCAAAAC
JMFS102H11+ CCAAAAC
                      ____________________________________________________________
consensus AAACAGCTTTGCTGGAAATCCACTTCTTGGGATACTGTGTTTCAACTGGAGTCCCAAAAC
 
. : . : . : . : . : . :
JMSF040B05+ TGCAGTTGCAAGATGTAAAGCAGCCAGTATTATTACGTCCAGCAGCCACAGTAGGTAACC
JMFS103A05+ TGCAGTTGCAAGATGTAAAGCAGCCAGTATTATTACGTCCAGCAGCCACAGTAGGTAACC
JMFS102H11+ TGCAGTTGCAAGATGTAAAGCAGCCAGTATTATTACGTCCAGCAGCCACAGTAGGTAACC
                      ____________________________________________________________
consensus TGCAGTTGCAAGATGTAAAGCAGCCAGTATTATTACGTCCAGCAGCCACAGTAGGTAACC
 
. : . : . : . : . : . :
JMSF040B05+ CCTCAGCGGCACATATACATATCCACTTGCTTTGGCTTGAGCCATCAGGATTGCAATCAC
JMFS103A05+ CCTCAGCGGCACATATACATATCCACTTGCTTTGGCTTGAGCCATCAGGATTGCAATCAC
JMFS102H11+ CCTCAGCGGCACATATACATATCCACTTGCTTTGGCTTGAGCCATCAGGATTGCAATCAC
                      ____________________________________________________________
consensus CCTCAGCGGCACATATACATATCCACTTGCTTTGGCTTGAGCCATCAGGATTGCAATCAC
 
. : . : . : . : . : . :
JMSF040B05+ AGGATGAGGAACAGTTAGCAGCACTAGCAATACTCAAGTTGGTGAAACAGGTGCATGTCC
JMFS103A05+ AGGATGAGGAACAGTTAGCAGCACTAGCAATACTCAAGTTGGTGAAACAGGTGCATGTCC
JMFS102H11+ AGGATGAGGAACAGTTAGCAGCACTAGCAATACTCAAGTTGGTGAAACAGGTGCATGTCC
                      ____________________________________________________________
consensus AGGATGAGGAACAGTTAGCAGCACTAGCAATACTCAAGTTGGTGAAACAGGTGCATGTCC
 
. : . : . : . : . : . :
JMSF040B05+ ACTTACTTGTCTCAGATGAATTAGAAGGCCCCTC
JMFS103A05+ ACTTACTTGTCTCAGATGAATTAGAAGGCCCCTC
JMFS102H11+ ACTTACTTGTCTCAGATGAATTAGAAGGCCCCTCTGAGAAATAATAAATAAATTACTTTT
                      ____________________________________________________________
consensus ACTTACTTGTCTCAGATGAATTAGAAGGCCCCTCTGAGAAATAATAAATAAATTACTTTT
 
. : . : . : . : . : . :
JMFS102H11+ ACAACTTAGCAAGGTATTTACATGGTCAAATTGCAATAGAAATTGAAGCAAGCAGTTAGC
                      ____________________________________________________________
consensus ACAACTTAGCAAGGTATTTACATGGTCAAATTGCAATAGAAATTGAAGCAAGCAGTTAGC
 
. : . : . : . : . : . :
JMFS102H11+ AGTTTTCTATTTTAATAAAAGAGAAAGAAAACTATTTCTGCTCCTAAGACAGACACTTGG
                      ____________________________________________________________
consensus AGTTTTCTATTTTAATAAAAGAGAAAGAAAACTATTTCTGCTCCTAAGACAGACACTTGG