Previous Contig 003700:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS022A09Sequence636003700 (3)sp|Q9Y871|FAEB_PIREQ0.003Feruloyl esterase B precursor (EC 3.1.1.73) (Ferulic acid esterase B) (Esterase
JMFS102E01Sequence516003700 (3)sp|Q9Y871|FAEB_PIREQ6e-06Feruloyl esterase B precursor (EC 3.1.1.73) (Ferulic acid esterase B) (Esterase
JMFS153B03Sequence619003700 (3)sp|Q9Y871|FAEB_PIREQ1e-04Feruloyl esterase B precursor (EC 3.1.1.73) (Ferulic acid esterase B) (Esterase

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS022A09+ GTCCTCCTCATCATGTCCACAATT
JMFS153B03+ CAATT
                      ____________________________________________________________
consensus GTCCTCCTCATCATGTCCACAATT
 
. : . : . : . : . : . :
JMFS022A09+ TTCACACTCTTCTTGTCACTGTCACTCTGCTTACAAGAATGGTTTGGGCAGCCACAACAA
JMFS153B03+ TTCACACTCTTCTTGTCACTGTCACTCTGCTTACAAGAATGGTTTGGGCAGCCACAACAA
                      ____________________________________________________________
consensus TTCACACTCTTCTTGTCACTGTCACTCTGCTTACAAGAATGGTTTGGGCAGCCACAACAA
 
. : . : . : . : . : . :
JMFS022A09+ TGATGATGTTCTGTGGTGGGGAAATTCTTTTCAAATTCATAACGTGGCTGGTCTGTTGAA
JMFS153B03+ TGATGATGTTCTGTGGTGGGGAAATTCTTTTCAAATTCATAACGTGGCTGGTCTGTTGAA
                      ____________________________________________________________
consensus TGATGATGTTCTGTGGTGGGGAAATTCTTTTCAAATTCATAACGTGGCTGGTCTGTTGAA
 
. : . : . : . : . : . :
JMFS022A09+ AAATATGGGGGAGGAGGTACATAATGAACAGGATACGATCCGGGATAGGCAGAATATATG
JMFS153B03+ AAATATGGGGGAGGAGGTACATAATGAACAGGATACGATCCGGGATAGGCAGAATATATG
JMFS102E01+ TGAACAGGATACGATCCGGGATAGGCAGAATATATG
                      ____________________________________________________________
consensus AAATATGGGGGAGGAGGTACATAATGAACAGGATACGATCCGGGATAGGCAGAATATATG
 
. : . : . : . : . : . :
JMFS022A09+ CCATGACAATGATGAGGTGGAGCAGCATAAGGATAAGGAGGTCTGAAAGCACAGCAGCTT
JMFS153B03+ CCATGACAATGATGAGGTGGAGCAGCATAAGGATAAGGAGGTCTGAAAGCACAGCAGCTT
JMFS102E01+ CCATGACAATGATGAGGTGGAGCAGCATAAGGATAAGGAGGTCTGAAAGCACAGCAGCTT
                      ____________________________________________________________
consensus CCATGACAATGATGAGGTGGAGCAGCATAAGGATAAGGAGGTCTGAAAGCACAGCAGCTT
 
. : . : . : . : . : . :
JMFS022A09+ GGTTGAGGAGGTTGATAATGGCAGCCATGGAATTCTGGAACTGGATATGCATAGCCGCCG
JMFS153B03+ GGTTGAGGAGGTTGATAATGGCAGCCATGGAATTCTGGAACTGGATATGCATAGCCGCCG
JMFS102E01+ GGTTGAGGAGGTTGATAATGGCAGCCATGGAATTCTGGAACTGGATATGCATAGCCGCCG
                      ____________________________________________________________
consensus GGTTGAGGAGGTTGATAATGGCAGCCATGGAATTCTGGAACTGGATATGCATAGCCGCCG
 
. : . : . : . : . : . :
JMFS022A09+ CCTTGATTGCCACCAAACTGAAACGGCCAAAATTCACAAGGCACCATTGGGTCCACTTTC
JMFS153B03+ CCTTGATTGCCACCAAACTGAAACGGCCAAAATTCACAAGGCACCATTGGGTCCACTTTC
JMFS102E01+ CCTTGATTGCCACCAAACTGAAACGGCCAAAATTCACAAGGCACCATTGGGTCCACTTTC
                      ____________________________________________________________
consensus CCTTGATTGCCACCAAACTGAAACGGCCAAAATTCACAAGGCACCATTGGGTCCACTTTC
 
. : . : . : . : . : . :
JMFS022A09+ AAATGAGGCCTGCCAATTTGACCGCTTGGACAATAATATGGGGCAGACATCACTTGATTC
JMFS153B03+ AAATGAGGCCTGCCAATTTGACCGCTTGGACAATAATATGGGGCAGACATCACTTGATTC
JMFS102E01+ AAATGAGGCCTGCCAATTTGACCGCTTGGACAATAATATGGGGCAGACATCACTTGATTC
                      ____________________________________________________________
consensus AAATGAGGCCTGCCAATTTGACCGCTTGGACAATAATATGGGGCAGACATCACTTGATTC
 
. : . : . : . : . : . :
JMFS022A09+ CTATGGTATGGGTAATATGAATCCATCCACCTTTTCACAGAATAGTATGATTGTCCTTCA
JMFS153B03+ CTATGGTATGGGTAATATGAATCCATCCACCTTTTCACAGAATAGTATGATTGTCCTTCA
JMFS102E01+ CTATGGTATGGGTAATATGAATCCATCCACCTTTTCACAGAATAGTATGATTGTCCTTCA
                      ____________________________________________________________
consensus CTATGGTATGGGTAATATGAATCCATCCACCTTTTCACAGAATAGTATGATTGTCCTTCA
 
. : . : . : . : . : . :
JMFS022A09+ GAAATCAAAGTATGTAAAAAACTAGAAAAACAAAAACCACCAATCTGTTCCACGAATCCA
JMFS153B03+ GAAATCAAAGTGTGTAAAAAACTAGAAAAACAAAAACCACCAATCTGTTCCACGAATCCA
JMFS102E01+ GAAATCAAAGTGTGTAAAAAACTAGAAAAACAAAAACCACCAATCTGTTCCACGAATCCA
                      ____________________________________________________________
consensus GAAATCAAAGTGTGTAAAAAACTAGAAAAACAAAAACCACCAATCTGTTCCACGAATCCA
 
. : . : . : . : . : . :
JMFS022A09+ GATGACTCAGTTGTCAGCTCAAATCGATCCACCAACCCAAAAAAAGAAGGAAAAAAATCG
JMFS153B03+ GATGACTCAGTTGTCAGCTCAAATCGATCCACCAACCCAAAAAAAGAAGGAAAAAAATCG
JMFS102E01+ GATGACTCAGTTGTCAGCTCAAATCGATCCACCAACCCAAAAAAAGAAGGAAAAAAATCG
                      ____________________________________________________________
consensus GATGACTCAGTTGTCAGCTCAAATCGATCCACCAACCCAAAAAAAGAAGGAAAAAAATCG
 
. : . : . : . : . : . :
JMFS022A09+ GAGCGCAGTTGT
JMFS153B03+ GAGCGCAGTTGT
JMFS102E01+ GAGCGCAGTTGTTTATCTGATCAGTACCTTTCTGATTTTTATTTTTTTTCCTGAAATTCC
                      ____________________________________________________________
consensus GAGCGCAGTTGTTTATCTGATCAGTACCTTTCTGATTTTTATTTTTTTTCCTGAAATTCC