Previous Contig 003695:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037H01Sequence537003695 (3)716003120 (4)gb:AY579881_16160232e-05Medicago truncatula AML1 mRNA, complete cds.
JMFS101G02Sequence614003695 (3)
JMSF025G07Sequence611003695 (3)718003120 (4)gb:AY579881_16160232e-10Medicago truncatula AML1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025G07+ TCAGAGTCATTGGGG
JMFS101G02+ CAGAGTCATTGGGG
                      ____________________________________________________________
consensus TCAGAGTCATTGGGG
 
. : . : . : . : . : . :
JMSF025G07+ ATTAATTTTTCATGTGGAAGAACAGGCAACGAGCTGGAGAACAAGCTAACATCTGTTGCG
JMFF037H01+ CG
JMFS101G02+ ATTAATTTTTCATGTGGAAGAACAGGCAACGAGCTGGAGAACAAGCTAACATCTGTTGCG
                      ____________________________________________________________
consensus ATTAATTTTTCATGTGGAAGAACAGGCAACGAGCTGGAGAACAAGCTAACATCTGTTGCG
 
. : . : . : . : . : . :
JMSF025G07+ GCATGATATGCAGCAGTTCCAAGAGGGATGGCCCACGCATTTCTTAGCCTCTCAGAAATG
JMFF037H01+ GCATGATATGCAGCAGTTCCAAGAGGGATGGCCCACGCATTTCTTAGCCTCTCAGAAATG
JMFS101G02+ GCATGATATGCAGCAGTTCCAAGAGGGATGGCCCACGCATTTCTTAGCCTCTCAGAAATG
                      ____________________________________________________________
consensus GCATGATATGCAGCAGTTCCAAGAGGGATGGCCCACGCATTTCTTAGCCTCTCAGAAATG
 
. : . : . : . : . : . :
JMSF025G07+ TTTGCTGCTGGAACTTTGTCTAGACCTCGAGAGTCACCTGAACCAGGTATCTTTGAAGGC
JMFF037H01+ TTTGCTGCTGGAACTTTGTCTAGACCTCGAGAGTCACCTGAACCAGGTATCTTTGAAGGC
JMFS101G02+ TTTGCTGCTGGAACTTTGTCTAGACCTCGAGAGTCACCTGAACCAGGTATCTTTGAAGGC
                      ____________________________________________________________
consensus TTTGCTGCTGGAACTTTGTCTAGACCTCGAGAGTCACCTGAACCAGGTATCTTTGAAGGC
 
. : . : . : . : . : . :
JMSF025G07+ GCATCCATTCAGAACTGCCTTCAAAATAACCACAAGTGTTCAGACTCCAAGAGATGCCAA
JMFF037H01+ GCATCCATTCAGAACTGCCTTCAAAATAACCNCAAGTGTTCAGACTCCAAGAGANGCCAA
JMFS101G02+ GCATCCATTCAGAACTGCCTTCAAAATAACCACAAGTGTTCAGACTCCAAGAGATGCCAA
                      ____________________________________________________________
consensus GCATCCATTCAGAACTGCCTTCAAAATAACCACAAGTGTTCAGACTCCAAGAGATGCCAA
 
. : . : . : . : . : . :
JMSF025G07+ ATTCAACGGAAGAAAATCTGTTCCCACCACACTGAATTATGAACTTTGCGCCTCGAAGAG
JMFF037H01+ ATTCAACGGAAGAAAATCTGTTCCCACCACACTGAATTATGANCTTTGCGCCTCGAAGAG
JMFS101G02+ ATTCAACGGAAGAAAATCTGTTCCCACCACACTGAATTATGAACTTTGCGCCTCGAAGAG
                      ____________________________________________________________
consensus ATTCAACGGAAGAAAATCTGTTCCCACCACACTGAATTATGAACTTTGCGCCTCGAAGAG
 
. : . : . : . : . : . :
JMSF025G07+ GGTCAAGCCAAGCCCCGAAGCTATTTAAGCAAGATCCTCAAAGAGAGAAAACTCTTGGAC
JMFF037H01+ GGTCAAGCCAAGCCCCGAAGCTATTTAAGCAAGATCCTCAAAGAGAGAAAACTCTTGGAC
JMFS101G02+ GGTCAAGCCAAGCCCCGAAGCTATTTAAGCAAGATCCTCAAAGAGAGAAAACTCTTGGAC
                      ____________________________________________________________
consensus GGTCAAGCCAAGCCCCGAAGCTATTTAAGCAAGATCCTCAAAGAGAGAAAACTCTTGGAC
 
. : . : . : . : . : . :
JMSF025G07+ TCGGTTATGGAAGTAGCAAGAATAACAAGAAGAAAGGGTGGACGAAGAAATATAAGCACA
JMFF037H01+ TCGGTTATGGAAGTAGCAAGAATAACAAGAAGAAAGGGTGGACGAAGAAATATAAGCACA
JMFS101G02+ TCGGTTATGGAAGTAGCAAGAATAACAAGAAGAAAGGGTGGACGAAGAAATATAAGCACA
                      ____________________________________________________________
consensus TCGGTTATGGAAGTAGCAAGAATAACAAGAAGAAAGGGTGGACGAAGAAATATAAGCACA
 
. : . : . : . : . : . :
JMSF025G07+ AAAAAAACAGTTTCGTAAAAGCAGAGGAATTGTTTTCTTCTACTCTTTTACTTCCTTCTC
JMFF037H01+ AAAAAAACAGTTTCGTAAAAGCAGAGGAATTGTTTTCTTCTACTCTTTTACTTCCTTCTC
JMFS101G02+ AAAAAAACAGTTTCGTAAAAGCAGAGGAATTGTTTTCTTCTACTCTTTTACTTCCTTCTC
                      ____________________________________________________________
consensus AAAAAAACAGTTTCGTAAAAGCAGAGGAATTGTTTTCTTCTACTCTTTTACTTCCTTCTC
 
. : . : . : . : . : . :
JMSF025G07+ TCCCGCCGGAACACTAGTTAGGAGAGAGAAATCCCAGTGTAGAGAGAGAGAGAGAGAGAG
JMFF037H01+ TCCCGCCGGAACACTAGTTAGGAGAGAGAAATCCCAGTGTAGAGAGAGAGAGAGAGAGAG
JMFS101G02+ TCCCGCCGGAACACTAGTTAGGAGAGAGAAATCCCAGTGTAGAGAGAGAGAGAGAGAGAG
                      ____________________________________________________________
consensus TCCCGCCGGAACACTAGTTAGGAGAGAGAAATCCCAGTGTAGAGAGAGAGAGAGAGAGAG
 
. : . : . : . : . : . :
JMSF025G07+ AGAATTGGGACCAAACCCGCATACCAAAACACAACACAGAGACACACACGACTAC
JMFF037H01+ AGAATTGGGACCAAACCCGCATACCAAAACACAACACAGAGACACACACGACTAC
JMFS101G02+ AGAATTGGGACCAAACCCGCATACCAAAACACAACACAGAGACACACACGACTACACGAG
                      ____________________________________________________________
consensus AGAATTGGGACCAAACCCGCATACCAAAACACAACACAGAGACACACACGACTACACGAG