Previous Contig 003694:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001O22Sequence490003694 (11)pir|H71447|H714479e-28trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV221003376 (7)gb:A67842_14502874e-20Sequence 14 from Patent WO9742326.
JMFF010D02Sequence520003694 (11)pir|H71447|H714473e-44trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV704003376 (7)gb:BT005967_16388898e-83Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops
JMFS014B01Sequence594003694 (11)pir|H71447|H714475e-45trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV
JMFS025E11Sequence605003694 (11)pir|H71447|H714471e-17trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV
JMFS065A02Sequence620003694 (11)pir|H71447|H714472e-70trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV
JMFS101F12Sequence616003694 (11)pir|H71447|H714471e-16trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV
JMFS118F07Sequence604003694 (11)pir|H71447|H714472e-25trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV
JMFS140H04Sequence628003694 (11)pir|H71447|H714473e-42trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV
JMFS163H03Sequence595003694 (11)pir|H71447|H714473e-16trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV
JMSF002O09Sequence233003694 (11)pir|H71447|H714471e-08trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV682003376 (7)gb:BT005967_16388895e-87Arabidopsis thaliana At4g17770 gene, complete cds.>gb:AK118703_1816666 Arabidops
JMSF033H08Sequence678003694 (11)pir|H71447|H714471e-45trehalose-6-phosphate synthase homolog DL4920W - Arabidopsis thaliana>gb:ATCHRIV

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS065A02+ ACGCTTGCCACAGGTTACGGTCGAACCTGCCACCGAGATCCGGGGAGAGAGGAAG
                      ____________________________________________________________
consensus ACGCTTGCCACAGGTTACGGTCGAACCTGCCACCGAGATCCGGGGAGAGAGGAAG
 
. : . : . : . : . : . :
JMFS065A02+ CATGTAATGGAACAAAGGCCACAGCTGCTGTTTACAAAAACCGTGGTAGAATTTGCTGAA
                      ____________________________________________________________
consensus CATGTAATGGAACAAAGGCCACAGCTGCTGTTTACAAAAACCGTGGTAGAATTTGCTGAA
 
. : . : . : . : . : . :
JMFS065A02+ GAGCTCGGGGGGAACGAAAGCCGGGACACATTTGAACGTCTCGAGCAACGTTTGTGCCAC
JMFS014B01+ GGAACGAAAGCCGGGACACATTTGAACGTCTCGAGCAACGTNTGTGCCAC
JMFS140H04+ GGGACACATTTGAACGTCTCGAGCAACGTNTGTGCCAC
JMFF010D02+ GGAACGAAAGCCGGGACACATTTGAACGTCTCGAGCAACGTTTGTGCCAC
JMSF033H08+ GGAACGAAAGCCGGGACACATTTGAACGTCTCGAGCAACGTTTGTGCCAC
                      ____________________________________________________________
consensus GAGCTCGGGGGGAACGAAAGCCGGGACACATTTGAACGTCTCGAGCAACGTTTGTGCCAC
 
. : . : . : . : . : . :
JMFS065A02+ ATCGTCTTGCTCGTTCGGGTCGATTATTTCTTCCTTGAGACAACCAACATAAATCACTTC
JMFS014B01+ ATCGTCTTGCTCGTTCGGGTCGATTATTTCTTCCTTGAGACAACCAACATAAATCACTTC
JMFS140H04+ ATCGTCTTGCTCGTTCGGGTCGATTATTTCTTCCTTGAGACAACCAACATAAATCACTTC
JMFF010D02+ ATCGTCTTGCTCGTTCGGGTCGATTATTTCTTCCTTGAGACAACCAACATAAATCACTTC
JMSF033H08+ ATCGTCTTGCTCGTTCGGGTCGATTATTTCTTCCTTGAGACAACCAACATAAATCACTTC
                      ____________________________________________________________
consensus ATCGTCTTGCTCGTTCGGGTCGATTATTTCTTCCTTGAGACAACCAACATAAATCACTTC
 
. : . : . : . : . : . :
JMFS065A02+ CACATCTTCCCCGAGCCCATCTTTGAGCTGCAAGAGAAGAGAATCCTCGTCCCAACTAAA
JMFS014B01+ CACATCTTCCCCGAGCCCATCTTTGAGCTGCAAGAGAAGAGAATCCTCGTCCCAACTAAA
JMFS140H04+ CACATCTTCCCCGAGCCCATCTTTGAGCTGCAAGAGAAGAGAATCCTCGTCCCAACTAAA
JMFF010D02+ CACATCTTCCCCGAGCCCATCTTTGAGCTGCAAGAGAAGAGAATCCTCGTCCCAACTAAA
JMFF001O22+ TTCCCCGAGCCCATCTTTGAGCTGCAAGAGAAGAGAATCCTCGTCCCAANTAAA
JMSF033H08+ CACATCTTCCCCGAGCCCATCTTTGAGCTGCAAGAGAAGAGAATCCTCGTCCCAACTAAA
JMFS118F07+ GAGCTGCAAGAGAAGAGAATCCTCGTCCCAACTAAA
                      ____________________________________________________________
consensus CACATCTTCCCCGAGCCCATCTTTGAGCTGCAAGAGAAGAGAATCCTCGTCCCAACTAAA
 
. : . : . : . : . : . :
JMFS065A02+ GTTCCACCCTTCTTCCCCATCCGTTCTCCTATGCGCCCGAAGTGGAAGCTGGTTCCCAAC
JMFS014B01+ GTTCCACCCTTCTTCCCCATCCGTTCTCCTATGCGCCCGAAGTGGAAGCTGGTTCCCAAC
JMFS140H04+ GTTCCACCCTTCTTCCCCATCCGTTCTCCTATGCGCCCGAAGTGGAAGCTGGTTCCCAAC
JMFF010D02+ GTTCCACCCTTCTTCCCCATCCGTTCTCCTATGCGCCCGAAGTGGAAGCTGGTTCCCAAC
JMFF001O22+ GTTCCACCCTTCTTCCCCATCCGTTCTCCTATGCGCCCGAAGTGGAAGCTGGTTCCCAAC
JMSF033H08+ GTTCCACCCTTCTTCCCCATCCGTTCTCCTATGCGCCCGAAGTGGAAGCTGGTTCCCAAC
JMFS118F07+ GTTCCACCCTTCTTCCCCATCCGTTCTCCTATGCGCCCGAAGTGGAAGCTGGTTCCCAAC
JMFS163H03+ AGCTGGTTCCCAAC
JMFS025E11+ GTGGAAGCTGGTTCCCAAC
JMFS101F12+ GAAGCTGGTTCCCAAC
                      ____________________________________________________________
consensus GTTCCACCCTTCTTCCCCATCCGTTCTCCTATGCGCCCGAAGTGGAAGCTGGTTCCCAAC
 
. : . : . : . : . : . :
JMFS065A02+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMFS014B01+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMFS140H04+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMFF010D02+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMFF001O22+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMSF033H08+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMFS118F07+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMFS163H03+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMFS025E11+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
JMFS101F12+ AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
                      ____________________________________________________________
consensus AATAATCATCCTCTCTTGAGAAATCGAGGAGGGAACATCCGACCCACCATTGCTTCTACT
 
. : . : . : . : . : . :
JMFS065A02+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMFS014B01+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMFS140H04+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMFF010D02+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMFF001O22+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMSF033H08+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMFS118F07+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMFS163H03+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMSF002O09+ TCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMFS025E11+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
JMFS101F12+ CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
                      ____________________________________________________________
consensus CTCGTCGTCGAGCTCAGATAACACCCCGGCTACAGTGGCAACCCGGGAGAGTTTCTTCCC
 
. : . : . : . : . : . :
JMFS065A02+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMFS014B01+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMFS140H04+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMFF010D02+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMFF001O22+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMSF033H08+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMFS118F07+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMFS163H03+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMSF002O09+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMFS025E11+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
JMFS101F12+ CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
                      ____________________________________________________________
consensus CGCCCGCCCAAAAGTTAGGGATTCACCAGAAGCAAGGTCCAATAAGTTCGAGTATGACCT
 
. : . : . : . : . : . :
JMFS065A02+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMFS014B01+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMFS140H04+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMFF010D02+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMFF001O22+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMSF033H08+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMFS118F07+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMFS163H03+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMSF002O09+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMFS025E11+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
JMFS101F12+ CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
                      ____________________________________________________________
consensus CGAAACCATTGTCGATTCACCACAATATATACACCTCTCGAAAATCAACAAAACCAGCAA
 
. : . : . : . : . : . :
JMFS065A02+ GTGATAGAAATCAAACTCT
JMFS014B01+ GTGATAGAAATCAAACTCT
JMFS140H04+ GTGATAGAAATCAAACTCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGTAGATAAT
JMFF010D02+ GTGATAGAAATCAAACTCT
JMFF001O22+ GTGATAGAAATCAAACTCT
JMSF033H08+ GTGATAGAAATCAAACTCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGTAGATAAT
JMFS118F07+ GTGATAGAAATCAAACTCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGTAGATAAT
JMFS163H03+ GTGATAGAAATCAAACTCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGTAGATAAT
JMSF002O09+ GTGATAGAAATCAAACTCTG
JMFS025E11+ GTGATAGAAATCAAACTCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGTAGATAAT
JMFS101F12+ GTGATAGAAATCAAACTCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGTAGATAAT
                      ____________________________________________________________
consensus GTGATAGAAATCAAACTCTGAATAAATGACAAAATCAAGAAAACCCAAGCAGTAGATAAT
 
. : . : . : . : . : . :
JMFS140H04+ CCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAATCTTCCA
JMSF033H08+ CCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAATCTTCCA
JMFS118F07+ CCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAATCTTCCA
JMFS163H03+ CCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAATCTTCCA
JMFS025E11+ CCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAATCTTCCA
JMFS101F12+ CCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAATCTTCCA
                      ____________________________________________________________
consensus CCATCATTAAAGATGAGAAAAAGCAATAACCACTGAAATCGAAAGCTACCCAATCTTCCA
 
. : . : . : . : . : . :
JMFS140H04+ TCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAG
JMSF033H08+ TCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACTAGTAAAA
JMFS118F07+ TCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACTAGTAAAA
JMFS163H03+ TCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACTAGTAAAA
JMFS025E11+ TCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACTAGTAAAA
JMFS101F12+ TCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACTAGTAAAA
                      ____________________________________________________________
consensus TCAAGAGCAGTAATGTCCAAGAGAGTGCGAGAGAATCCACTAGGCTAGTTACTAGTAAAA
 
. : . : . : . : . : . :
JMSF033H08+ GCAACACTACAACTAATTCAAAC
JMFS118F07+ GCAACACTACAACTAATTCAAACAAATATTCTGAGGTTTCAACAAAGTGAATAAATTACT
JMFS163H03+ GCAACACTACAACTAATTCAAACAAATATTCTGAGGTTTCAACAAAGTGAATAAATTACT
JMFS025E11+ GCAACACTACAACTAATTCAAACAAATATTCTGAGGTTTCAACAAAGTGAATAAATTACT
JMFS101F12+ GCAACACTACAACTAATTCAAACAAATATTCTGAGGTTTCAACAAAGTGAATAAATTACT
                      ____________________________________________________________
consensus GCAACACTACAACTAATTCAAACAAATATTCTGAGGTTTCAACAAAGTGAATAAATTACT
 
. : . : . : . : . : . :
JMFS118F07+ ATACTGTTTGCCAGTGCTCGCACGTAGC
JMFS163H03+ ATACTGTTTGCCAGTGCTCGCACGTAGCAAAAACAAAGAACCCAAAATAATATAAATAAA
JMFS025E11+ ATACTGTTTGCCAGTGCTCGCACGTAGCAAAAACAAAGAACCCAAAATAATATAAATAAA
JMFS101F12+ ATACTGTTTGCCAGTGCTCGCACGTAGCAAAAACAAAGAACCCAAAATAATATAAATAAA
                      ____________________________________________________________
consensus ATACTGTTTGCCAGTGCTCGCACGTAGCAAAAACAAAGAACCCAAAATAATATAAATAAA
 
. : . : . : . : . : . :
JMFS163H03+ TAAAAATGACCAATCAGTAAGCAAACTACAGTAAATAAGAA
JMFS025E11+ TAAAAATGACCAATCAGTAAGCAAACTACAGTAAATAAGAACCTTT
JMFS101F12+ TAAAAATGACCAATCAGTAAGCAAACTACAGTAAATAAGAACCTTTGATAGTTTGAGAGA
                      ____________________________________________________________
consensus TAAAAATGACCAATCAGTAAGCAAACTACAGTAAATAAGAACCTTTGATAGTTTGAGAGA