Previous Contig 003677:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS099G12Sequence627003677 (2)gb:AB084380_15243353e-43Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.
JMFS099H11Sequence627003677 (2)gb:AB084380_15243353e-43Zinnia elegans ZeHB-10 mRNA for homeobox leucine-zipper protein, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS099H11+ CTTGTTCATTGCTGTCAACTTTCGATT
JMFS099G12+ CTTGTTCATTGCTGTCAACTTTCGATT
                      ____________________________________________________________
consensus CTTGTTCATTGCTGTCAACTTTCGATT
 
. : . : . : . : . : . :
JMFS099H11+ CACGGCTTGGAGACGAGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAA
JMFS099G12+ CACGGCTTGGAGACGAGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAA
                      ____________________________________________________________
consensus CACGGCTTGGAGACGAGACGACTCTTTTCGCTGTTTCTCCCTGCATCTTCTATTCTGAAA
 
. : . : . : . : . : . :
JMFS099H11+ CCAAACTTTGATCTGTTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTG
JMFS099G12+ CCAAACTTTGATCTGTTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTG
                      ____________________________________________________________
consensus CCAAACTTTGATCTGTTTTGGCTCGATATTGGAAAGAATTGAACACTCCCTGATGAGCTG
 
. : . : . : . : . : . :
JMFS099H11+ CTGCCTGCGAAGCGAACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGAT
JMFS099G12+ CTGCCTGCGAAGCGAACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGAT
                      ____________________________________________________________
consensus CTGCCTGCGAAGCGAACTTGGCTTTGGACATTCATGATACAGCCTCTCCAGAGCCTCGAT
 
. : . : . : . : . : . :
JMFS099H11+ CTGCTCCGGTGTGTACCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTT
JMFS099G12+ CTGCTCCGGTGTGTACCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTT
                      ____________________________________________________________
consensus CTGCTCCGGTGTGTACCGCACATATTTCCCATTGTCCAATCCCATTTTCCCACTCTCTTT
 
. : . : . : . : . : . :
JMFS099H11+ ACAGCTCGATGTCACCGCCATCATCATGTATGATTTGCAGCTAGCTAGCTAGCTAGCTAT
JMFS099G12+ ACAGCTCGATGTCACCGCCATCATCATGTATGATTTGCAGCTAGCTAGCTAGCTAGCTAT
                      ____________________________________________________________
consensus ACAGCTCGATGTCACCGCCATCATCATGTATGATTTGCAGCTAGCTAGCTAGCTAGCTAT
 
. : . : . : . : . : . :
JMFS099H11+ ATACCTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCCACTCTCT
JMFS099G12+ ATACCTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCCACTCTCT
                      ____________________________________________________________
consensus ATACCTCTGTCCTTTTTCTGCAAGCTTGAAAAATAAATTCCCAGCAATAATCCACTCTCT
 
. : . : . : . : . : . :
JMFS099H11+ ACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGAGATCTTC
JMFS099G12+ ACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGAGATCTTC
                      ____________________________________________________________
consensus ACCGTACAAACGCTTCCTTCACAGCCACGCAGCGTGAAGCACAAGGCTGCTGAGATCTTC
 
. : . : . : . : . : . :
JMFS099H11+ CATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAACCAACCA
JMFS099G12+ CATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAACCAACCA
                      ____________________________________________________________
consensus CATCATTGGATCGCCACTTCCCTAATCTTCGTGAATTGGTCTCACCCCACCAACCAACCA
 
. : . : . : . : . : . :
JMFS099H11+ AGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTTGTATATA
JMFS099G12+ AGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTTGTATATA
                      ____________________________________________________________
consensus AGCCTCAAAGACGTGAAAAGCTCCACTCTTTCTCAAACTCTAAACTTCTGTTTGTATATA
 
. : . : . : . : . : . :
JMFS099H11+ GGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACAGAAGAGA
JMFS099G12+ GGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACAGAAGAGA
                      ____________________________________________________________
consensus GGGGTTTGTTTGTGAGTGTATGTACGTGTATATATATGTATATATGAAGAACAGAAGAGA