Previous Contig 003671:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS099D03Sequence620003671 (2)gb:AE005173_8934511e-10Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC002328_153
JMFS133F08Sequence606003671 (2)gb:AE005173_8934514e-18Arabidopsis thaliana chromosome 1, bottom arm complete sequence.>gb:AC002328_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS133F08+ GTA
                      ____________________________________________________________
consensus GTA
 
. : . : . : . : . : . :
JMFS133F08+ GTACCCTCTNTGTTTNTTCTAGATCATATTCTACGGACTTGATCCTGTCCAAGGATTGAT
                      ____________________________________________________________
consensus GTACCCTCTNTGTTTNTTCTAGATCATATTCTACGGACTTGATCCTGTCCAAGGATTGAT
 
. : . : . : . : . : . :
JMFS133F08+ GCAGCATNTGCTCCTTCTCCAATGGCATCTCGGTAGGCTTCTTGTTTAGCTCTTCGATTA
JMFS099D03+ CTTGTTTAGCTCTTCGATTA
                      ____________________________________________________________
consensus GCAGCATNTGCTCCTTCTCCAATGGCATCTCGGTAGGCTTCTTGTTTAGCTCTTCGATTA
 
. : . : . : . : . : . :
JMFS133F08+ ATTGTTCAAGCCTCTGAAGGCGTTCGATACATGGATGGAAATGGTCTTCTTCACTCGCAG
JMFS099D03+ ATTGTTCAAGCCTCTGAAGGCGTTCGATACATGGATGGAAATGGTCTTCTTCACTCGCAG
                      ____________________________________________________________
consensus ATTGTTCAAGCCTCTGAAGGCGTTCGATACATGGATGGAAATGGTCTTCTTCACTCGCAG
 
. : . : . : . : . : . :
JMFS133F08+ CTTCATTATTACTAGGTAAATGAGAATCGTGCTTCTCTTCCAATGCACTAGAAGGGTAAA
JMFS099D03+ CTTCATTATTACTAGGTAAATGAGAATCGTGCTTCTCTTCCAATGCACTAGAAGGGTAAA
                      ____________________________________________________________
consensus CTTCATTATTACTAGGTAAATGAGAATCGTGCTTCTCTTCCAATGCACTAGAAGGGTAAA
 
. : . : . : . : . : . :
JMFS133F08+ CGTCTGTCTGTCTCCGCCACGACTCAAAAGGGAGAGTCCGGATAGTCGCAAACAGTTTGA
JMFS099D03+ CGTCTGTCTGTCTCCGCCACGACTCAAAAGGGAGAGTCCGGATAGTCGCAAACAGTTTGA
                      ____________________________________________________________
consensus CGTCTGTCTGTCTCCGCCACGACTCAAAAGGGAGAGTCCGGATAGTCGCAAACAGTTTGA
 
. : . : . : . : . : . :
JMFS133F08+ GTGTCGAAGATATCACTCTTCTTGTCAAATAGCCGAAACATCTGCTCACGAGCTTTTCTT
JMFS099D03+ GTGTCGAAGATATCACTCTTCTTGTCAAATAGCCGAAACATCTGCTCACGAGCTTTTCTT
                      ____________________________________________________________
consensus GTGTCGAAGATATCACTCTTCTTGTCAAATAGCCGAAACATCTGCTCACGAGCTTTTCTT
 
. : . : . : . : . : . :
JMFS133F08+ GGATGTCATCTAACCAATGAACCAAAACAGCACCTTGAGAATTTGGTACTCCATCAGCAT
JMFS099D03+ GGATGTCATCTAACCAATGAACCAAAACAGCACCTTGAGAATTTGGTACTCCATCAGCAT
                      ____________________________________________________________
consensus GGATGTCATCTAACCAATGAACCAAAACAGCACCTTGAGAATTTGGTACTCCATCAGCAT
 
. : . : . : . : . : . :
JMFS133F08+ ATGAATCCATATCATTCCTTCCAGATGAGTGAGCTCGATAATGCTGTAATACTTGCTCAC
JMFS099D03+ ATGAATCCATATCATTCCTTCCAGATGAGTGAGCTCGATAATGCTGTAATACTTGCTCAC
                      ____________________________________________________________
consensus ATGAATCCATATCATTCCTTCCAGATGAGTGAGCTCGATAATGCTGTAATACTTGCTCAC
 
. : . : . : . : . : . :
JMFS133F08+ TGCCAATTTCTCTATCACTCGGGCTTAAGCCATCATCACAACTATAATAAGGAGTTGAGT
JMFS099D03+ TGCCAATTTCTCTATCACTCGGGCTTAAGCCATCATCACAACTATAATAAGGAGTTGAGT
                      ____________________________________________________________
consensus TGCCAATTTCTCTATCACTCGGGCTTAAGCCATCATCACAACTATAATAAGGAGTTGAGT
 
. : . : . : . : . : . :
JMFS133F08+ TCAATGCCCTTGCTTCTTCAAGAACAGGG
JMFS099D03+ TCAATGCCCTTGCTTCTTCAAGAACAGGGGCAAGCCTTGAACACGTGCTGCTACTTTGTT
                      ____________________________________________________________
consensus TCAATGCCCTTGCTTCTTCAAGAACAGGGGCAAGCCTTGAACACGTGCTGCTACTTTGTT
 
. : . : . : . : . : . :
JMFS099D03+ CACACAGAGCATAGGGATCATCAATGTCCGAAAAGGATTCAATTCTTGATTTATCGCTGA
                      ____________________________________________________________
consensus CACACAGAGCATAGGGATCATCAATGTCCGAAAAGGATTCAATTCTTGATTTATCGCTGA
 
. : . : . : . : . : . :
JMFS099D03+ TTCTCCCCTTCAGTGGGCAGATCTGAAAATAGGAATCAATGTTCTGTTGGTTACTAGTTC
                      ____________________________________________________________
consensus TTCTCCCCTTCAGTGGGCAGATCTGAAAATAGGAATCAATGTTCTGTTGGTTACTAGTTC