Previous Contig 003670:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H07Sequence566003670 (18)pir|T01385|T013858e-39probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>751003400 (9)gb:FSY298828_16794122e-22Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMFF003G09Sequence588003670 (18)pir|T01385|T013854e-50probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>787008270 (2)sp|Q8L7U5|BSL1_ARATHe-134Serine/threonine protein phosphatase BSL1 (EC 3.1.3.16) (BSU1-like protein 1).>g
JMFF006J23Sequence236003670 (18)767003400 (9)gb:FSY298828_16794121e-52Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMFF014J24Sequence512003670 (18)pir|T01385|T013851e-24probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>688003400 (9)gb:FSY298828_16794129e-12Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMFF022F07Sequence407003670 (18)pir|T01385|T013854e-20probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>719008270 (2)sp|Q8L7U5|BSL1_ARATHe-127Serine/threonine protein phosphatase BSL1 (EC 3.1.3.16) (BSU1-like protein 1).>g
JMFS009E01Sequence601003670 (18)gb:AC104283_1737487e-101Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1607_F09, complete s
JMFS011B06Sequence566003670 (18)pir|T01385|T013854e-60probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMFS024B08Sequence617003670 (18)pir|T01385|T013852e-51probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMFS043A03Sequence627003670 (18)pir|T01385|T013859e-69probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMFS067G06Sequence639003670 (18)pir|T01385|T013851e-64probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMFS091H03Sequence627003670 (18)pir|T01385|T013859e-95probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMFS097E02Sequence616003670 (18)pir|T01385|T013853e-62probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMFS099C12Sequence627003670 (18)pir|T01385|T013851e-38probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMFS118G03Sequence619003670 (18)pir|T01385|T013852e-62probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMFS148A02Sequence620003670 (18)pir|T01385|T013854e-63probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>
JMSF012M20Sequence514003670 (18)pir|T01385|T013853e-36probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>748003400 (9)gb:FSY298828_16794124e-54Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMSF038P17Sequence662003670 (18)pir|T01385|T013857e-49probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>863003400 (9)gb:FSY298828_16794123e-55Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).
JMSF050H22Sequence663003670 (18)pir|T01385|T013853e-71probable phosphoprotein phosphatase (EC 3.1.3.16) T4I9.4 - Arabidopsis thaliana>751003400 (9)gb:FSY298828_16794124e-54Fagus sylvatica partial mRNA for protein phosphatase (pp1-1 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS009E01+ TCC
                      ____________________________________________________________
consensus TCC
 
. : . : . : . : . : . :
JMFS009E01+ ACAGCACGACCACCCCTAAGTACACCTCCTGTAACATGTAATCGTGCACCAACAAAGACC
                      ____________________________________________________________
consensus ACAGCACGACCACCCCTAAGTACACCTCCTGTAACATGTAATCGTGCACCAACAAAGACC
 
. : . : . : . : . : . :
JMFS009E01+ GAAGCATGTTGGTACCTTGGTGAAGCTGCAACCCCAGGAGCAAGAGTCCATTCCCATTGG
                      ____________________________________________________________
consensus GAAGCATGTTGGTACCTTGGTGAAGCTGCAACCCCAGGAGCAAGAGTCCATTCCCATTGG
 
. : . : . : . : . : . :
JMFS009E01+ CCATTTCTATGCATGAGTAGTCCATAAGCATCTGCCAGGGGCGTGCCTGAAGCATCTCTC
JMFS091H03+ TAAGCATCTGCCAGGGGCGTGCCTGAAGCATCTCTC
                      ____________________________________________________________
consensus CCATTTCTATGCATGAGTAGTCCATAAGCATCTGCCAGGGGCGTGCCTGAAGCATCTCTC
 
. : . : . : . : . : . :
JMFS009E01+ CCACCACAGAGCAAAAACATCCCATCTGAGCGCGCACTTGCAGTTGCATACATTCTACCA
JMFS091H03+ CCACCACAGAGCAAAAACATCCCATCTGAGCGCGCACTTGCAGTTGCATACATTCTACCA
                      ____________________________________________________________
consensus CCACCACAGAGCAAAAACATCCCATCTGAGCGCGCACTTGCAGTTGCATACATTCTACCA
 
. : . : . : . : . : . :
JMFS009E01+ GAGGGTCTATCACCTTCTGGATTCAGCCTTTGCCAGGCATATGGTTTCTGAGCAGTATCC
JMFS091H03+ GAGGGTCTATCACCTTCTGGATTCAGCCTTTGCCAGGCATATGGTTTCTGAGCAGTATCC
                      ____________________________________________________________
consensus GAGGGTCTATCACCTTCTGGATTCAGCCTTTGCCAGGCATATGGTTTCTGAGCAGTATCC
 
. : . : . : . : . : . :
JMFS009E01+ AAAGCCCAGGCATCCGACAGAACTCTCTTCCCATCATTGCCACTAAAGCTAACAAGATAT
JMFS091H03+ AAAGCCCAGGCATCCGACAGAACTCTCTTCCCATCATTGCCACTAAAGCTAACAAGATAT
JMSF050H22+ CAAGATAT
                      ____________________________________________________________
consensus AAAGCCCAGGCATCCGACAGAACTCTCTTCCCATCATTGCCACTAAAGCTAACAAGATAT
 
. : . : . : . : . : . :
JMFS009E01+ CTTTGTGCAACCAAGTCCATAACATGGCCGTATCTTGGGCCAGGACCCTGGCCTTGAACT
JMFS091H03+ CTTTGTGCAACCAAGTCCATAACATGGCCGTATCTTGGGCCAGGACCCTGGCCTTGAACT
JMFS067G06+ GCAACCAAGTCCATAACATGGCCGTATC-TGGGCCAGGACCCTGGCCTTGAACT
JMFS011B06+ GGCCTTGAACT
JMFS043A03+ CAACCAAGTCCATAACATGGCCGTATCTTGGGCCAGGACCCTGGCCTTGAACT
JMFS097E02+ GGGCCAGGACCCTGGCCTTGAACT
JMFS148A02+ TGGGCCAGGACCCTGGCCTTGAACT
JMFS118G03+ TTGGGCCAGGACCCTGGCCTTGAACT
JMSF050H22+ CTTTGTGCAACCAAGTCCATAACATGGCCGTATCTTGGGCCAGGACCCTGGCCTTGAACT
JMSF038P17+ CTTGAACT
                      ____________________________________________________________
consensus CTTTGTGCAACCAAGTCCATAACATGGCCGTATCTTGGGCCAGGACCCTGGCCTTGAACT
 
. : . : . : . : . : . :
JMFS009E01+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMFS091H03+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMFS067G06+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMFS011B06+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMFS043A03+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMFS097E02+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMFS148A02+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMFS118G03+ ACAACTCGGTGCCATTTCAATNTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMSF050H22+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
JMFF003G09+ GAACATATAGGTCGTCAGTT
JMFS024B08+ TCAAGTCAAGAACATATAGGTCGTCAGTT
JMSF038P17+ ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
                      ____________________________________________________________
consensus ACAACTCGGTGCCATTTCAATTTGTCATTGGTCAAGTCAAGAACATATAGGTCGTCAGTT
 
. : . : . : . : . : . :
JMFS009E01+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFS091H03+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFS067G06+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFS011B06+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFS043A03+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFS097E02+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFS148A02+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFS118G03+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMSF050H22+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFF003G09+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMFS024B08+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMSF038P17+ GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
JMSF012M20+ ACAGCTGCAGCT
JMFF002H07+ CAACCATAGTTCCAACAGCTGCAGCT
JMFS099C12+ ACAACCATAGTTCCAACAGCTGCAGCT
                      ____________________________________________________________
consensus GAATGGCCAGCAGGTCCTATGCCGCCCTGAAATACAACCATAGTTCCAACAGCTGCAGCT
 
. : . : . : . : . : . :
JMFS009E01+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTC
JMFS091H03+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFS067G06+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFS011B06+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFS043A03+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFS097E02+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFS148A02+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFS118G03+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMSF050H22+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFF003G09+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFS024B08+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMSF038P17+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCCCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMSF012M20+ GCATGTGCGNCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFF002H07+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
JMFS099C12+ GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
                      ____________________________________________________________
consensus GCATGTGCGGCCCTTGGTGAAGGTGGCTCTCCAGCTGGTTGTAGTCTGGTCCATTTTCTG
 
. : . : . : . : . : . :
JMFS091H03+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFS067G06+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFS011B06+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFS043A03+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFS097E02+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFS148A02+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFS118G03+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMSF050H22+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFF003G09+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFS024B08+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMSF038P17+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMSF012M20+ GTGAGAACATCATANGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFF022F07+ AAGACGGATGCCGGGGCCA
JMFF002H07+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFF014J24+ ACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
JMFS099C12+ GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
                      ____________________________________________________________
consensus GTGAGAACATCATAAGAATGAATAGCATTGGTTACGCCGGCAAGACGGATGCCGGGGCCA
 
. : . : . : . : . : . :
JMFS091H03+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFS067G06+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFS011B06+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFS043A03+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFS097E02+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFS148A02+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFS118G03+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMSF050H22+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFF003G09+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFS024B08+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMSF038P17+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMSF012M20+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFF022F07+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFF002H07+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFF014J24+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
JMFS099C12+ CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
                      ____________________________________________________________
consensus CCATTGCCGCCTTCAATAGCGGTGGCGCCGCCAAAGAGGATGAGACGGGGGCCGTGCGTT
 
. : . : . : . : . : . :
JMFS091H03+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCG
JMFS067G06+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFS011B06+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFS043A03+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFS097E02+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFS148A02+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFS118G03+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMSF050H22+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFF003G09+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFS024B08+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMSF038P17+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACC----GCGTCTTCATCG
JMSF012M20+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFF022F07+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFF002H07+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFF014J24+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
JMFS099C12+ TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
                      ____________________________________________________________
consensus TTGGTGGCGGCGACGGCGGTGAGGGTGTGGCCGCAGCGGGGACCGGGAGCGTCTTCATCG
 
. : . : . : . : . : . :
JMFS067G06+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFS011B06+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFS043A03+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFS097E02+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFS148A02+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFS118G03+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMSF050H22+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFF003G09+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFS024B08+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMSF038P17+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMSF012M20+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFF022F07+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFF006J23+ ATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFF002H07+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFF014J24+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
JMFS099C12+ GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
                      ____________________________________________________________
consensus GTGTCCCAGAATGTCTCTAAGCTACGATAAGTTGGAGCTGGATAAAGCCACGGCTTGGCA
 
. : . : . : . : . : . :
JMFS067G06+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFS011B06+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFS043A03+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFS097E02+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFS148A02+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFS118G03+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMSF050H22+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFF003G09+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFS024B08+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMSF038P17+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMSF012M20+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFF022F07+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFF006J23+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFF002H07+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFF014J24+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
JMFS099C12+ GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
                      ____________________________________________________________
consensus GCCATCCCATCCAGCTCTGCTCCACCAATCAAACAACCGGAGGATTGATTGGCACGCAGA
 
. : . : . : . : . : . :
JMFS067G06+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFS011B06+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFS043A03+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFS097E02+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFS148A02+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFS118G03+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMSF050H22+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFF003G09+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFS024B08+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMSF038P17+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMSF012M20+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFF022F07+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFF006J23+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFF002H07+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFF014J24+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
JMFS099C12+ TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
                      ____________________________________________________________
consensus TCAAAGAGGAACACACTTGAATTACCACATCACCAACGCCGAGAAGAAAGGCCGCCGGAA
 
. : . : . : . : . : . :
JMFS067G06+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAAC
JMFS011B06+ TCCGGTGAAGTTTTC
JMFS043A03+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGAT
JMFS097E02+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACT
JMFS148A02+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGT
JMFS118G03+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTG
JMSF050H22+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGT
JMFF003G09+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
JMFS024B08+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
JMSF038P17+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
JMSF012M20+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
JMFF022F07+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
JMFF006J23+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
JMFF002H07+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
JMFF014J24+ TCCGGTGAAGTTTTCAACGATCCGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
JMFS099C12+ TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
                      ____________________________________________________________
consensus TCCGGTGAAGTTTTCAACGATCTGAGAGAGAGATAGAGAGCGAAACAGAACTGTGATTCT
 
. : . : . : . : . : . :
JMFF003G09+ TTCTTACTTTTTCAAGTCGATGAGTAGT
JMFS024B08+ TTCTTACTTTTTCAAGTCGATGAGTAGTGGGGAGGGGGTTTTGCCGTT
JMSF038P17+ TTCTTACTTTTTCAAGTCGATGAGTAGTGGGGAGGGGGTTTTGCCGTTTTGGAAAG
JMSF012M20+ TTCTTACTTTTTCAAGTCGAT
JMFF022F07+ TTCTTACTTTTTCAAGTCGATGAGTAGT
JMFF006J23+ TTCTT
JMFF002H07+ TTCTTACTTTTTCAAGTCGATGAGTAGTGGGGAGGGGGTTTTGCCGTTTTGGAAAG
JMFF014J24+ TTCTTACTTTTTCAAGTCGATGAGTAGTGGGGAGGGGGTTTTGCCGTTTTGGAAAGCGAA
JMFS099C12+ TTCTTACTTTTTCAAGTCGATGAGTAGTGGGGAGGGGGTTTTGCCGTTTTGGAAAGCGAA
                      ____________________________________________________________
consensus TTCTTACTTTTTCAAGTCGATGAGTAGTGGGGAGGGGGTTTTGCCGTTTTGGAAAGCGAA
 
. : . : . : . : . : . :
JMFF014J24+ TGCAAAAGACCGATTTTGGGGTTTTTCTTTTTTCCTTT
JMFS099C12+ TGCAAAAGACCGATTTTGGGGTTTTTCTTTTTTCCTTTTTTTTTTTTTTCAAAAATCGTT
                      ____________________________________________________________
consensus TGCAAAAGACCGATTTTGGGGTTTTTCTTTTTTCCTTTTTTTTTTTTTTCAAAAATCGTT