Previous Contig 003668:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS023C08Sequence529003668 (3)pir|T48059|T480593e-53ABC transporter-like protein - Arabidopsis thaliana>gb:ATF26K9_1550117 Arabidops
JMFS081G05Sequence625003668 (3)pir|T48059|T480591e-64ABC transporter-like protein - Arabidopsis thaliana>gb:ATF26K9_1550117 Arabidops
JMFS099B03Sequence624003668 (3)pir|T48059|T480591e-62ABC transporter-like protein - Arabidopsis thaliana>gb:ATF26K9_1550117 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS023C08+ GCTAGT
                      ____________________________________________________________
consensus GCTAGT
 
. : . : . : . : . : . :
JMFS023C08+ TGTATCCTTTGCTTCTGGCCACCACTGAGGTTGATTCCGCGTTCTCCTATCTCTGTTTGG
                      ____________________________________________________________
consensus TGTATCCTTTGCTTCTGGCCACCACTGAGGTTGATTCCGCGTTCTCCTATCTCTGTTTGG
 
. : . : . : . : . : . :
JMFS023C08+ TCACCGTGTTCTAGAATTTCCATATCTTTCTCCAGCGAACAAGCTCTTATGACCTCTTTG
                      ____________________________________________________________
consensus TCACCGTGTTCTAGAATTTCCATATCTTTCTCCAGCGAACAAGCTCTTATGACCTCTTTG
 
. : . : . : . : . : . :
JMFS023C08+ TATCTTTCAATGTTCATTGGTGAACCAAACAAGATGTTATCTTGAACAGTTGCATTTTGA
JMFS081G05+ TGTTCATTGGTGAACCAAACAAGATGTTATCTTGAACAGTTGCATTTTGA
                      ____________________________________________________________
consensus TATCTTTCAATGTTCATTGGTGAACCAAACAAGATGTTATCTTGAACAGTTGCATTTTGA
 
. : . : . : . : . : . :
JMFS023C08+ ATCCATGATGTCTGGGCTACATAAGCAGTTGTTCCACAAACTCTGACTCTTCCTGTGGAT
JMFS081G05+ ATCCATGATGTCTGGGCTACATAAGCAGTTGTTCCACAAACTCTGACTCTTCCTGTGGAT
                      ____________________________________________________________
consensus ATCCATGATGTCTGGGCTACATAAGCAGTTGTTCCACAAACTCTGACTCTTCCTGTGGAT
 
. : . : . : . : . : . :
JMFS023C08+ TTATGAAGTTCACCCAGAAGCGAAGCTAACAAGGAAGACTTTCCTGATCCAACAGTTCCA
JMFS081G05+ TTATGAAGTTCACCCAGAAGCGAAGCTAACAAGGAAGACTTTCCTGATCCAACAGTTCCA
                      ____________________________________________________________
consensus TTATGAAGTTCACCCAGAAGCGAAGCTAACAAGGAAGACTTTCCTGATCCAACAGTTCCA
 
. : . : . : . : . : . :
JMFS023C08+ ACAATTGCAGCAAGTTCTCCCTTTCTGACTTCAAAGTTGATATCTTTCAAGATAATTTGG
JMFS081G05+ ACAATTGCAGCAAGTTCTCCCTTTCTGACTTCAAAGTTGATATCTTTCAAGATAATTTGG
                      ____________________________________________________________
consensus ACAATTGCAGCAAGTTCTCCCTTTCTGACTTCAAAGTTGATATCTTTCAAGATAATTTGG
 
. : . : . : . : . : . :
JMFS023C08+ TTGCCTTCATCGTCCCACGAAAAATTTGCTTGTTTCACCTCCACTGCAATTCGACCATCG
JMFS081G05+ TTGCCTTCATCGTCCCACGAAAAATTTGCTTGTTTCACCTCCACTGCAATTCGACCATCG
JMFS099B03+ ACCTCCACTGCAATTCGACCATCG
                      ____________________________________________________________
consensus TTGCCTTCATCGTCCCACGAAAAATTTGCTTGTTTCACCTCCACTGCAATTCGACCATCG
 
. : . : . : . : . : . :
JMFS023C08+ CAATAATCTTCCTCTCTTTCAACTATCTTAGGGTCCAATTCATGGCTTGTGAGATAGTTA
JMFS081G05+ CAATAATCTTCCTCTCTTTCAACTATCTTAGGGTCCAATTCATGGCTTGTGAGATAGTTA
JMFS099B03+ CAATAATCTTCCTCTCTTTCAACTATCTTAGGGTCCAATTCATGGCTTGTGAGATAGTTA
                      ____________________________________________________________
consensus CAATAATCTTCCTCTCTTTCAACTATCTTAGGGTCCAATTCATGGCTTGTGAGATAGTTA
 
. : . : . : . : . : . :
JMFS023C08+ TCCAGC
JMFS081G05+ TCCAGCCTGTTGAGAGATGTAATGGCTTGTGAGAGATAGATTAAACACTGAGGAAAGGTT
JMFS099B03+ TCCAGCCTGTTGAGAGATGTAATGGCTTGTGAGAGATAGATTAAACACTGAGGAAAGGTT
                      ____________________________________________________________
consensus TCCAGCCTGTTGAGAGATGTAATGGCTTGTGAGAGATAGATTAAACACTGAGGAAAGGTT
 
. : . : . : . : . : . :
JMFS081G05+ CGGATAGGCTCCTGCAAGATTTTCAAGACTGTTGTTGCTGTGAAAACTGTGCCGGCATCA
JMFS099B03+ CGGATAGGCTCCTGCAAGATTTTCAAGACTGTTGTTGCTGTGAAAACTGTGCCGGCATCA
                      ____________________________________________________________
consensus CGGATAGGCTCCTGCAAGATTTTCAAGACTGTTGTTGCTGTGAAAACTGTGCCGGCATCA
 
. : . : . : . : . : . :
JMFS081G05+ AGAGGGACTTTCATCCAAATTGCAACAGCAAAAGTAAGAGCTGAGATCAGAGTGGGAACA
JMFS099B03+ AGAGGGACTTTCATCCAAATTGCAACAGCAAAAGTAAGAGCTGAGATCAGAGTGGGAACA
                      ____________________________________________________________
consensus AGAGGGACTTTCATCCAAATTGCAACAGCAAAAGTAAGAGCTGAGATCAGAGTGGGAACA
 
. : . : . : . : . : . :
JMFS081G05+ CTCCACAGTACAGAGAAGTTCAAAAAAACCAAATACATGATTTTAGTAAGCCAGCTGAAC
JMFS099B03+ CTCCACAGTACAGAGAAGTTCAAAAAAACCAAATACATGATTTTAGTAAGCCAGCTGAAC
                      ____________________________________________________________
consensus CTCCACAGTACAGAGAAGTTCAAAAAAACCAAATACATGATTTTAGTAAGCCAGCTGAAC
 
. : . : . : . : . : . :
JMFS081G05+ TCAACTCCACGAAATGATTGTATTTTGTTGCTGAA
JMFS099B03+ TCAACTCCACGAAATGATTGTATTTTGTTGCTGAAGTGCTCTTCCCACGCTTGAAACTTA
                      ____________________________________________________________
consensus TCAACTCCACGAAATGATTGTATTTTGTTGCTGAAGTGCTCTTCCCACGCTTGAAACTTA
 
. : . : . : . : . : . :
JMFS099B03+ ATCACACGCATGTTGCTCAGCAACTCATTTACAGCTTTCATCCTCAGGTCGCGATTCTCC
                      ____________________________________________________________
consensus ATCACACGCATGTTGCTCAGCAACTCATTTACAGCTTTCATCCTCAGGTCGCGATTCTCC
 
. : . : . : . : . : . :
JMFS099B03+ ATCAGTCTGAACTGAAACAAGTTGTTCATACGCGAAACTATCAACGTGAAGATGATCACT
                      ____________________________________________________________
consensus ATCAGTCTGAACTGAAACAAGTTGTTCATACGCGAAACTATCAACGTGAAGATGATCACT
 
. : . : . : . : . : . :
JMFS099B03+ CCAACAATGGCAACCAAGGATGCCATCACTGGTACACCAATGTATAGGTAGAGGAGAAAT
                      ____________________________________________________________
consensus CCAACAATGGCAACCAAGGATGCCATCACTGGTACACCAATGTATAGGTAGAGGAGAAAT
 
. : . : . : . : . : . :
JMFS099B03+ AAGGCTGCCGTAAGTTGTATTGGCATCATCCACAATGAATGGAGCTGTGGTATCATATCA
                      ____________________________________________________________
consensus AAGGCTGCCGTAAGTTGTATTGGCATCATCCACAATGAATGGAGCTGTGGTATCATATCA