Previous Contig 003665:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS010A10Sequence605003665 (3)gb:AY051007_15624842e-48Arabidopsis thaliana unknown protein (At1g55040) mRNA, complete cds.
JMFS098H05Sequence616003665 (3)gb:AY051007_15624841e-31Arabidopsis thaliana unknown protein (At1g55040) mRNA, complete cds.
JMSF040O17Sequence547003665 (3)gb:AY051007_15624842e-24Arabidopsis thaliana unknown protein (At1g55040) mRNA, complete cds.834023926

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS010A10+ GACATGTTTCCTCAATAGTTTGGCAGAAAATACAACCCTCTTGTCTGCAC
                      ____________________________________________________________
consensus GACATGTTTCCTCAATAGTTTGGCAGAAAATACAACCCTCTTGTCTGCAC
 
. : . : . : . : . : . :
JMFS010A10+ TAGGGCATCCATAGCCAACAAAAATTTGAAGATCATGTCTTGACAATGCCCTTAAGATGT
JMFS098H05+ AATGCCCTTAAGATGT
                      ____________________________________________________________
consensus TAGGGCATCCATAGCCAACAAAAATTTGAAGATCATGTCTTGACAATGCCCTTAAGATGT
 
. : . : . : . : . : . :
JMFS010A10+ CAAATCTATCGCGACCAAAGTTGAGAACAGCAGTCTGAACAGTCTTCCAATCCCTAGTAA
JMSF040O17+ CCTAGTAA
JMFS098H05+ CAAATCTATCGCGACCAAAGTTGAGAACAGCAGTCTGAACAGTCTTCCAATCCCTAGTAA
                      ____________________________________________________________
consensus CAAATCTATCGCGACCAAAGTTGAGAACAGCAGTCTGAACAGTCTTCCAATCCCTAGTAA
 
. : . : . : . : . : . :
JMFS010A10+ AATCGAACCCTTCCTGTTCTACGGCATCGGAAACACTAAAGCCCAAGTCTTCAATCATTT
JMSF040O17+ AATCGAACCCTTCCTGTTCTACGGCATCGGAAACACTAAAGCCCAAGTCTTCAATCATTT
JMFS098H05+ AATCGAACCCTTCCTGTTCTACGGCATCGGAAACACTAAAGCCCAAGTCTTCAATCATTT
                      ____________________________________________________________
consensus AATCGAACCCTTCCTGTTCTACGGCATCGGAAACACTAAAGCCCAAGTCTTCAATCATTT
 
. : . : . : . : . : . :
JMFS010A10+ TATCCTCGTCTTTCCTCTTATGATCGAAGTAATTCTGCTGCACCAGCCTCTCCATCAGCT
JMSF040O17+ TATCCTCGTCTTTCCTCTTATGATCGAAGTAATTCTGCTGCACCAGCCTCTCCATCAGCT
JMFS098H05+ TATCCTCGTCTTTCCTCTTATGATCGAAGTAATTCTGCTGCACCAGCCTCTCCATCAGCT
                      ____________________________________________________________
consensus TATCCTCGTCTTTCCTCTTATGATCGAAGTAATTCTGCTGCACCAGCCTCTCCATCAGCT
 
. : . : . : . : . : . :
JMFS010A10+ CAATCCACTCCGGCCAAGGGTGAACCAACTCCACCTCCTTATCCATCAACCCCCCGCCGT
JMSF040O17+ CAATCCACTCCGGCCAAGGGTGAACCAACTCCACCTCCTTATCCATCAACCCCCCGCCGT
JMFS098H05+ CAATCCACTCCGGCCAAGGGTGAACCAACTCCACCTCCTTATCCATCAACCCCCCGCCGT
                      ____________________________________________________________
consensus CAATCCACTCCGGCCAAGGGTGAACCAACTCCACCTCCTTATCCATCAACCCCCCGCCGT
 
. : . : . : . : . : . :
JMFS010A10+ GACCAACAAGAGAACACCTCTCCTTCGACTTATCAGGAACCGAATCGACATCTGAAACCT
JMSF040O17+ GACCAACAAGAGAACACCTCTCCTTCGACTTATCAGGAACCGAATCGACATCTGAAACCT
JMFS098H05+ GACCAACAAGAGAACACCTCTCCTTCGACTTATCAGGAACCGAATCGACATCTGAAACCT
                      ____________________________________________________________
consensus GACCAACAAGAGAACACCTCTCCTTCGACTTATCAGGAACCGAATCGACATCTGAAACCT
 
. : . : . : . : . : . :
JMFS010A10+ CGCTCTGAGTTTGCGATTGCGGCGGCTGGGGTTGGGACTGTGATAGAGTGGTGGACTTCT
JMSF040O17+ CGCTCTGAGTTTGCGATTGCGGCGGCTGGGGTTGGGACTGTGATAGAGTGGTGGACTTCT
JMFS098H05+ CGCTCTGAGTTTGCGATTGCGGCGGCTGGGGTTGGGACTGTGATAGAGTGGTGGACTTCT
                      ____________________________________________________________
consensus CGCTCTGAGTTTGCGATTGCGGCGGCTGGGGTTGGGACTGTGATAGAGTGGTGGACTTCT
 
. : . : . : . : . : . :
JMFS010A10+ TGGATTCGCGCCAAGCGCGTATGCGTTGGAGGGTCTGGTCTTTCTCGGCGTGCTCTTTCT
JMSF040O17+ TGGATTCGCGCCAAGCGCGTATGCGTTGGAGGGTCTGGTCTTTCTCGGCGTGCTCTTTCT
JMFS098H05+ TGGATTCGCGCCAAGCGCGTATGCGTTGGAGGGTCTGGTCTTTCTCGGCGTGCTCTTTCT
                      ____________________________________________________________
consensus TGGATTCGCGCCAAGCGCGTATGCGTTGGAGGGTCTGGTCTTTCTCGGCGTGCTCTTTCT
 
. : . : . : . : . : . :
JMFS010A10+ CGATGGCGTCAATTTGATCAAAGACGAAGCGCATCCGGGCGGAGAGAGACGAGGGTTCAG
JMSF040O17+ CGATGGCGTCAATTTGATCAAAGACGAAGCGCATCCGGGCGGAGAGAGACGAGGGTTCAG
JMFS098H05+ CGATGGCGTCAATTTGATCAAAGACGAAGCGCATCCGGGCGGAGAGAGACGAGGGTTCAG
                      ____________________________________________________________
consensus CGATGGCGTCAATTTGATCAAAGACGAAGCGCATCCGGGCGGAGAGAGACGAGGGTTCAG
 
. : . : . : . : . : . :
JMFS010A10+ AGGGCGTGGGGCC
JMSF040O17+ AGGGCGTGGGGCCAGAGGTGGACGGGGTGGAGGAGAGAGAAGAAAGGAGTTTTAGAGAAA
JMFS098H05+ AGGGCGTGGGGCCAGAGGTGGACGGGGTGGAGGAGAGAGAAGAAAGGAGTTTTAGAGAAA
                      ____________________________________________________________
consensus AGGGCGTGGGGCCAGAGGTGGACGGGGTGGAGGAGAGAGAAGAAAGGAGTTTTAGAGAAA
 
. : . : . : . : . : . :
JMSF040O17+ GAAAGTTGAAGGGTTTAGGGTTTTGGGAAAAGAGGCGTCTGCGGAGGAGAACAGAGGT
JMFS098H05+ GAAAGTTGAAGGGTTTAGGGTTTTGGGAAAAGAGGCGTCTGCGGAGGAGAACAGAGGTGG
                      ____________________________________________________________
consensus GAAAGTTGAAGGGTTTAGGGTTTTGGGAAAAGAGGCGTCTGCGGAGGAGAACAGAGGTGG