Previous Contig 003663:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS098G12Sequence624003663 (2)gb:AF503763_18067642e-49Arabidopsis thaliana adenosine monophosphate binding protein 4 AMPBP4 (AMPBP4) m
JMFS153E05Sequence611003663 (2)gb:AY074543_15675853e-81Arabidopsis thaliana putative AMP-binding protein (At5g16340) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS153E05+ TTGCCTCGCCTTCAGTTTC
                      ____________________________________________________________
consensus TTGCCTCGCCTTCAGTTTC
 
. : . : . : . : . : . :
JMFS153E05+ GCCCGCTCCACCGCCGGCAATTCGTTCCATTTTGGTTTCCACACGCACGACACCACCACC
                      ____________________________________________________________
consensus GCCCGCTCCACCGCCGGCAATTCGTTCCATTTTGGTTTCCACACGCACGACACCACCACC
 
. : . : . : . : . : . :
JMFS153E05+ CCCGCCACCTCCGTCAGCCCGTACCCGTGGCTCACGATGAACCCCAGAGACTCGATGCGG
                      ____________________________________________________________
consensus CCCGCCACCTCCGTCAGCCCGTACCCGTGGCTCACGATGAACCCCAGAGACTCGATGCGG
 
. : . : . : . : . : . :
JMFS153E05+ AGGACGACGGCGGCGGGCGGCGGAGCCCCGCCGGTGAGGAAATGGACGGGGTTCTTGAGA
                      ____________________________________________________________
consensus AGGACGACGGCGGCGGGCGGCGGAGCCCCGCCGGTGAGGAAATGGACGGGGTTCTTGAGA
 
. : . : . : . : . : . :
JMFS153E05+ GGCTTAGCGCGCGGAGAATTCGCCAACATGTTGAGTACCACGGGCGCCCCGCACATGTGC
                      ____________________________________________________________
consensus GGCTTAGCGCGCGGAGAATTCGCCAACATGTTGAGTACCACGGGCGCCCCGCACATGTGC
 
. : . : . : . : . : . :
JMFS153E05+ GTAACGTTGTATCTTACTATGGACTCGTAAACGCCCTCGGCGTCGATTTTCCGCAGGCAG
                      ____________________________________________________________
consensus GTAACGTTGTATCTTACTATGGACTCGTAAACGCCCTCGGCGTCGATTTTCCGCAGGCAG
 
. : . : . : . : . : . :
JMFS153E05+ ACATTGGTGCCGCCGACGGCCGCCATTCCCCACGTGTAGCTCCACCCGTTGGAGTGGAAC
                      ____________________________________________________________
consensus ACATTGGTGCCGCCGACGGCCGCCATTCCCCACGTGTAGCTCCACCCGTTGGAGTGGAAC
 
. : . : . : . : . : . :
JMFS153E05+ ATCGGCAGCGTCCACAGGTAAACCGGCCGCTCCGGCACGAACCAACCGATCAACGAATCC
                      ____________________________________________________________
consensus ATCGGCAGCGTCCACAGGTAAACCGGCCGCTCCGGCACGAACCAACCGATCAACGAATCC
 
. : . : . : . : . : . :
JMFS153E05+ ACCGTCATGACGAAGATTGAGCGGTGAGAATGCACCACTCCTTTGGGAGATGAAGTGGTG
                      ____________________________________________________________
consensus ACCGTCATGACGAAGATTGAGCGGTGAGAATGCACCACTCCTTTGGGAGATGAAGTGGTG
 
. : . : . : . : . : . :
JMFS153E05+ CCGGAGGTATAATTCAGCGTCATCGCCTCCCATTCTCCGGCCGGCCGGATCCAATTGAAC
JMFS098G12+ CCGGCCGGCCGGATCCAATTGAAC
                      ____________________________________________________________
consensus CCGGAGGTATAATTCAGCGTCATCGCCTCCCATTCTCCGGCCGGCCGGATCCAATTGAAC
 
. : . : . : . : . : . :
JMFS153E05+ TCCGAATCCCCATTCCTCACCAGCCCCTCATACGTATCATATATCAGACTA
JMFS098G12+ TCCGAATCCCCATTCCTCACCAGCCCCTCATACGTATCATATATCAAACTATTCCTCGAA
                      ____________________________________________________________
consensus TCCGAATCCCCATTCCTCACCAGCCCCTCATACGTATCATATATCAGACTATTCCTCGAA
 
. : . : . : . : . : . :
JMFS098G12+ AACGTCGTCCACGCAACATCGTACCCGTCTTCAATCAGCACCACCGTCGGACGTTTAACC
                      ____________________________________________________________
consensus AACGTCGTCCACGCAACATCGTACCCGTCTTCAATCAGCACCACCGTCGGACGTTTAACC
 
. : . : . : . : . : . :
JMFS098G12+ CGCGGCGGGAGCAAAGAAACCGCCTCAAGAACCAACGGGCAGAACTGAAAATCCACGAAA
                      ____________________________________________________________
consensus CGCGGCGGGAGCAAAGAAACCGCCTCAAGAACCAACGGGCAGAACTGAAAATCCACGAAA
 
. : . : . : . : . : . :
JMFS098G12+ ACCATCTTCGATTCCCCGTGGGCCAGAATAACAGAGATCGTCCTCGCATCCAGTCGCGTG
                      ____________________________________________________________
consensus ACCATCTTCGATTCCCCGTGGGCCAGAATAACAGAGATCGTCCTCGCATCCAGTCGCGTG
 
. : . : . : . : . : . :
JMFS098G12+ TTAATGTTATTAATAACCGCGCCGGCCATGGGAACGGCGAATTGGAGCTCGTACGTAGCC
                      ____________________________________________________________
consensus TTAATGTTATTAATAACCGCGCCGGCCATGGGAACGGCGAATTGGAGCTCGTACGTAGCC
 
. : . : . : . : . : . :
JMFS098G12+ GGAATGTTGGGGGCGACGACGGAGACCACCTGGGCCCTCCCGGGGCCAATGACGGCGGAG
                      ____________________________________________________________
consensus GGAATGTTGGGGGCGACGACGGAGACCACCTGGGCCCTCCCGGGGCCAATGACGGCGGAG
 
. : . : . : . : . : . :
JMFS098G12+ ATGGACGAACCCAGACGGCGGCAGCGAGTGTAGGTTTCAGACCACGTGTAAACGGTGGAG
                      ____________________________________________________________
consensus ATGGACGAACCCAGACGGCGGCAGCGAGTGTAGGTTTCAGACCACGTGTAAACGGTGGAG
 
. : . : . : . : . : . :
JMFS098G12+ TTGTGTACCACGGAAGCGCATTCGCCGTAAACAATGGAAGCTCTTTCCAAGAACGATAAT
                      ____________________________________________________________
consensus TTGTGTACCACGGAAGCGCATTCGCCGTAAACAATGGAAGCTCTTTCCAAGAACGATAAT
 
. : . : . : . : . : . :
JMFS098G12+ GGCGTCAAGGGACAGGAATTGGACATGGTTGCTTTCAATTGGTCCATGGCTAGCTCAATA
                      ____________________________________________________________
consensus GGCGTCAAGGGACAGGAATTGGACATGGTTGCTTTCAATTGGTCCATGGCTAGCTCAATA
 
. : . : . : . : . : . :
JMFS098G12+ ATCTCTCTAAAATGGGTGTATGTATAGTTACTGCACAGTGCACAGAGAATTGAAGATTGA
                      ____________________________________________________________
consensus ATCTCTCTAAAATGGGTGTATGTATAGTTACTGCACAGTGCACAGAGAATTGAAGATTGA