Previous Contig 003659:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS031C10Sequence588003659 (5)pir|G86325|G863252e-46hypothetical protein T29M8.9 - Arabidopsis thaliana>gb:AE005172_890883 Arabidops
JMFS044H04Sequence613003659 (5)gb:AB112671_15271891e-96Cucumis sativus CsARF1 mRNA for auxin response factor 1, complete cds.
JMFS068B11Sequence614003659 (5)gb:AB112671_15271892e-97Cucumis sativus CsARF1 mRNA for auxin response factor 1, complete cds.
JMFS070A03Sequence624003659 (5)gb:AB112671_15271896e-57Cucumis sativus CsARF1 mRNA for auxin response factor 1, complete cds.
JMFS098E08Sequence627003659 (5)gb:AB112671_15271893e-98Cucumis sativus CsARF1 mRNA for auxin response factor 1, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS031C10+ TGCTGCTGCTGCTGCGGGGGCCACGTTGGGGATGGCGTCTGT
                      ____________________________________________________________
consensus TGCTGCTGCTGCTGCGGGGGCCACGTTGGGGATGGCGTCTGT
 
. : . : . : . : . : . :
JMFS031C10+ TGAAGCTGGGAAACTTGCTGATTTAGCTGATTTGGTTTGTTGAACTGGAGATTCTGGGCA
JMFS070A03+ AGCTGGGAAACTTGCTGATTTAGCTGATTTGGTNTGTTGAACTGGAGATTCTGGGCA
                      ____________________________________________________________
consensus TGAAGCTGGGAAACTTGCTGATTTAGCTGATTTGGTTTGTTGAACTGGAGATTCTGGGCA
 
. : . : . : . : . : . :
JMFS031C10+ GCAAAACCGGGGGACTGAAAGTTGAGGAGCCTGGAATGGTTATCCACGCCAAGGTTTCCT
JMFS070A03+ GCAAAACCGGGGGACTGAAAGTTGAGGAGCCTGGAATGGTTATCCACGCCAAGGTTTCCT
                      ____________________________________________________________
consensus GCAAAACCGGGGGACTGAAAGTTGAGGAGCCTGGAATGGTTATCCACGCCAAGGTTTCCT
 
. : . : . : . : . : . :
JMFS031C10+ TGCAAAGCGTTTTGGTTTTGGTTTTGATTCAGTCCCGATTGAGCTGGGACTTGCTGGTTA
JMFS070A03+ TGCAAAGCGTTTTGGTTTTGGTTTTGATTCAGTCCCGATTGAGCTGGGACTTGCTGGTTA
                      ____________________________________________________________
consensus TGCAAAGCGTTTTGGTTTTGGTTTTGATTCAGTCCCGATTGAGCTGGGACTTGCTGGTTA
 
. : . : . : . : . : . :
JMFS031C10+ GTCTGCTGCTGCATGCTCATCCATTGGACTAAGCTCAATCCAGGGAACATCGAGCTCGAC
JMFS070A03+ GTCTGCTGCTGCATGCTCATCCATTGGACTAAGCTCAATCCAGGGAACATCGAGCTCGAC
                      ____________________________________________________________
consensus GTCTGCTGCTGCATGCTCATCCATTGGACTAAGCTCAATCCAGGGAACATCGAGCTCGAC
 
. : . : . : . : . : . :
JMFS031C10+ GCATCTTTCAACCCGCCAAACTCATCCCCAATCCAAGGCATTCCTCTCCTGAACACATTC
JMFS070A03+ GCATCTTTCAACCCGCCAAACTCATCCCCAATCCAAGGCATTCCTCTCCTGAACACATTC
                      ____________________________________________________________
consensus GCATCTTTCAACCCGCCAAACTCATCCCCAATCCAAGGCATTCCTCTCCTGAACACATTC
 
. : . : . : . : . : . :
JMFS031C10+ TCCATATCTGACTCGTCGCCCATAAACCCAGGCTGTCTGGGAAACTTGGGTCTGAAAAAT
JMFS070A03+ TCCATATCTGACTCGTCGCCCATAAACCCAGGCTGTCTGGGAAACTTGGGTCTGAAAAAT
                      ____________________________________________________________
consensus TCCATATCTGACTCGTCGCCCATAAACCCAGGCTGTCTGGGAAACTTGGGTCTGAAAAAT
 
. : . : . : . : . : . :
JMFS031C10+ GGAGGAGGACAAATGTAAAAAGGAGTAACAACAGGCTCAATATCCCAAATTGAAACCCGA
JMFS070A03+ GGAGGAGGACAAATGTAAAAAGGAGTAACAACAGGCTCAATATCCCAAATTGAAACCCGA
                      ____________________________________________________________
consensus GGAGGAGGACAAATGTAAAAAGGAGTAACAACAGGCTCAATATCCCAAATTGAAACCCGA
 
. : . : . : . : . : . :
JMFS031C10+ GTTGGACGTTCCCCAGCAGTTGATTCATCCCATCCAACCTGAAGATTACGCCACTGTGAG
JMFS070A03+ GTTGGACGTTCCCCAGCAGTTGATTCATCCCATCCAACCTGAAGATTACGCCACTGTGAG
                      ____________________________________________________________
consensus GTTGGACGTTCCCCAGCAGTTGATTCATCCCATCCAACCTGAAGATTACGCCACTGTGAG
 
. : . : . : . : . : . :
JMFS031C10+ TTTTTCCATCGAACGGGATCGAGATCACTGATACCCGTGATTGTCCCCATGTACCTACGC
JMFS070A03+ TTTTTCCATCGAACGGGATCGAGATCACTGATACCCGTGATTGTCCCCATGTACCTACGC
                      ____________________________________________________________
consensus TTTTTCCATCGAACGGGATCGAGATCACTGATACCCGTGATTGTCCCCATGTACCTACGC
 
. : . : . : . : . : . :
JMFS031C10+ ACTCCA
JMFS070A03+ ACTCCAGACTCTTCGGTCTCAAACATCATCCTGAACCGCATGCCTAGAGAAACTTGAGTG
JMFS068B11+ CCGCATGCCTAGAGAAACTTGAGTG
JMFS044H04+ ATGCCTAGAGAAACTTGAGTG
JMFS098E08+ ATGCCTAGAGAAACTTGAGTG
                      ____________________________________________________________
consensus ACTCCAGACTCTTCGGTCTCAAACATCATCCTGAACCGCATGCCTAGAGAAACTTGAGTG
 
. : . : . : . : . : . :
JMFS070A03+ TACATAGCTTTGTTATACTTGGCAAGA
JMFS068B11+ TACATAGCTTTGTTATACTTGGCAAGAGGGATCACGAATTCGCAAGGGCTTGCCCTTGGA
JMFS044H04+ TACATAGCTTTGTTATACTTGGCAAGAGGGATCACGAATTCGCAAGGGCTTGCCCTTGGA
JMFS098E08+ TACATAGCTNTGTTATACTTGGCAAGAGGGATCACGAATTCGCAAGGGCTTGCCCTTGGA
                      ____________________________________________________________
consensus TACATAGCTTTGTTATACTTGGCAAGAGGGATCACGAATTCGCAAGGGCTTGCCCTTGGA
 
. : . : . : . : . : . :
JMFS068B11+ TTGTAAAAAATGGTAAACGGGCTATTATTTGCTGCAGCATGAGCTGCGGCCGCAAGGATT
JMFS044H04+ TTGTAAAAAATGGTAAACGGGCTATTATNTGCTGCAGCATGAGCTGCGGCCGCAAGGATT
JMFS098E08+ TTGTAAAAAATGGTAAACGGGCTATTATTTGCTGCAGCATGAGCTGCGGCCGCAAGGATT
                      ____________________________________________________________
consensus TTGTAAAAAATGGTAAACGGGCTATTATTTGCTGCAGCATGAGCTGCGGCCGCAAGGATT
 
. : . : . : . : . : . :
JMFS068B11+ CCAATGTGCATGCTGTCACTAGATATAACCGATGACGAAAGGGCGGGTTGTTGCCGGTTA
JMFS044H04+ CCAATGTGCATGCTGTCACTAGATATAACCGATGACGAAAGGGCGGGTTGTTGCCGGTTA
JMFS098E08+ CCAATGTGCATGCTGTCACTAGATATAACCGATGACGAAAGGGCGGGTTGTTGCCGGTTA
                      ____________________________________________________________
consensus CCAATGTGCATGCTGTCACTAGATATAACCGATGACGAAAGGGCGGGTTGTTGCCGGTTA
 
. : . : . : . : . : . :
JMFS068B11+ GCACGCTTTATACCCAAGAGAAGCTGTGACTTTTCATCCCTTATGAAAAGGACAGCATCT
JMFS044H04+ GCACGCTTTATACCCAAGAGAAGCTGTGACTTTTCATCCCTTATGAAAAGGACAGCATCT
JMFS098E08+ GCACGCTTTATACCCAAGAGAAGCTGTGACTTTTCATCCCTTATGAAAAGGACAGCATCT
                      ____________________________________________________________
consensus GCACGCTTTATACCCAAGAGAAGCTGTGACTTTTCATCCCTTATGAAAAGGACAGCATCT
 
. : . : . : . : . : . :
JMFS068B11+ CCAGCACAAAGTCTTTTCGACGACACAAAAACACTCCATCCAGTAGTCAATAGGTGCCTT
JMFS044H04+ CCAGCACAAAGTCTTTTCGACGACACAAAAACACTCCATCCAGTAGTCAATAGGTGCCTT
JMFS098E08+ CCAGCACAAAGTCTTTTCGACGACACAAAAACACTCCATCCAGTAGTCAATAGGTGCCTT
                      ____________________________________________________________
consensus CCAGCACAAAGTCTTTTCGACGACACAAAAACACTCCATCCAGTAGTCAATAGGTGCCTT
 
. : . : . : . : . : . :
JMFS068B11+ TTCGGTTGCCCTCGATATATATGTCTAAAAGTCCATGTTTGATCATGCAAGTCTCGGGAT
JMFS044H04+ TTCGGTTGCCCTCGATATATATGTCTAAAAGTCCATGTTTGATCATGCAAGTCTCGGGAT
JMFS098E08+ TTCGGTTGCCCTCGATATATATGTCTAAAAGTCCATGTTTGATCATGCAAGTCTCGGGAT
                      ____________________________________________________________
consensus TTCGGTTGCCCTCGATATATATGTCTAAAAGTCCATGTTTGATCATGCAAGTCTCGGGAT
 
. : . : . : . : . : . :
JMFS068B11+ ACTATCTCCTGAGCCGGAGGTTGCATCGAGTAATCCAGAGGTGGGAATATTTTCTCAGCT
JMFS044H04+ ACTATCTCCTGAGCCGGAGGTTGCATCGAGTAATCCAGAGGTGGGAATATTTTCTCAGCT
JMFS098E08+ ACTATCTCCTGAGCCGGAGGTTGCATCGAGTAATCCAGAGGTGGGAATATTTTCTCAGCT
                      ____________________________________________________________
consensus ACTATCTCCTGAGCCGGAGGTTGCATCGAGTAATCCAGAGGTGGGAATATTTTCTCAGCT
 
. : . : . : . : . : . :
JMFS068B11+ GCTCGACGAGGAACAGAAAAACCACCATGAGTGCTAGTATCACTAGCGGTGAGCGTCTTG
JMFS044H04+ GCTCGACGAGGAACAGAAAAACCACCATGAGTGCTAGTATCACTAGCGGTGAGCGTCTTG
JMFS098E08+ GCTCGACGAGGAACAGAAAAACCACCATGAGTGCTAGTATCACTAGCGGTGAGCGTCTTG
                      ____________________________________________________________
consensus GCTCGACGAGGAACAGAAAAACCACCATGAGTGCTAGTATCACTAGCGGTGAGCGTCTTG
 
. : . : . : . : . : . :
JMFS068B11+ CAGAAGAATTCAGTAGGTTGCCTGCTTTGCTTTAGCCCCATATCGGATATAAGCAAAGCT
JMFS044H04+ CAGAAGAATTCAGTAGGTTGCCTGCTTTGCTTTAGCCCCATATCGGATATAAGCAAAGCT
JMFS098E08+ CAGAAGAATTCAGTAGGTTGCCTGCTTTGCTTTAGCCCCATATCGGATATAAGCAAAGCT
                      ____________________________________________________________
consensus CAGAAGAATTCAGTAGGTTGCCTGCTTTGCTTTAGCCCCATATCGGATATAAGCAAAGCT
 
. : . : . : . : . : . :
JMFS068B11+ TCCTGATCGTATTTGTTTACAGGTTGAAGAGTCATCTGAGCGTAAACC
JMFS044H04+ TCCTGATCGTATTTGTTTACAGGTTGAAGAGTCATCTGAGCGTAAACC
JMFS098E08+ TCCTGATCGTATTTGTTTACAGGTTGAAGAGTCATCTGAGCGTAAACCTCATCAGATTCA
                      ____________________________________________________________
consensus TCCTGATCGTATTTGTTTACAGGTTGAAGAGTCATCTGAGCGTAAACCTCATCAGATTCA