Previous Contig 003654:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS097D11Sequence612003654 (4)gb:AY048198_15616602e-36Arabidopsis thaliana AT5g52920/MXC20_15 mRNA, complete cds.>gb:AY091682_1574693
JMFS164C09Sequence632003654 (4)gb:AY048198_15616601e-49Arabidopsis thaliana AT5g52920/MXC20_15 mRNA, complete cds.>gb:AY091682_1574693
JMSF008P04Sequence340003654 (4)750013700 (2)gb:AY048198_15616601e-63Arabidopsis thaliana AT5g52920/MXC20_15 mRNA, complete cds.>gb:AY091682_1574693
JMSF047D04Sequence653003654 (4)gb:AY048198_15616602e-62Arabidopsis thaliana AT5g52920/MXC20_15 mRNA, complete cds.>gb:AY091682_1574693 741013700 (2)gb:AY048198_15616607e-54Arabidopsis thaliana AT5g52920/MXC20_15 mRNA, complete cds.>gb:AY091682_1574693

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF047D04+ TGATTGGTTG
                      ____________________________________________________________
consensus TGATTGGTTG
 
. : . : . : . : . : . :
JMSF047D04+ GGGCAAGTCACCGCTCCTAACNTCAGGACCCTTGGTGTCAAGCATGATGGCAATGACGTT
JMFS164C09+ GCAATGACGTT
                      ____________________________________________________________
consensus GGGCAAGTCACCGCTCCTAACNTCAGGACCCTTGGTGTCAAGCATGATGGCAATGACGTT
 
. : . : . : . : . : . :
JMSF047D04+ GTCTTTGGATTGTGTGTTATATTCCTTAACCAAATCAATCACCTTCTGATGAGAAGCATG
JMFS164C09+ GTCTTNGGATTGTGTGTTATATCCCTTAACCAAATCAATCACCTTCTGATGAGAAGCATG
JMFS097D11+ GATGAGAAGCATG
                      ____________________________________________________________
consensus GTCTTTGGATTGTGTGTTATATTCCTTAACCAAATCAATCACCTTCTGATGAGAAGCATG
 
. : . : . : . : . : . :
JMSF047D04+ GTCTCCATGAGACATGTTGAGACGAGCAACATTCATTCCAGCTTCAGCCAACTTCCAGAT
JMFS164C09+ GTCTCCATGAGACATGTTGAGACGAGCAACATTCATTCCAGCTTCAGCCAACTTCCAGAT
JMFS097D11+ GTCTCCATGAGACATG-TGAGACGAGCAACATTCATTCCAGCTTCAGCCAACTTCCAGAT
                      ____________________________________________________________
consensus GTCTCCATGAGACATGTTGAGACGAGCAACATTCATTCCAGCTTCAGCCAACTTCCAGAT
 
. : . : . : . : . : . :
JMSF047D04+ CATTTCCTTTGTGTTGGTAGAGGGACCAATAGTGCAAACAATCTTAGTCTTACGCCTCAC
JMFS164C09+ CATTTCCTTTGTGTTGGTAGAGGGACCAATAGTGCAAACAATCTTAGTCTTACGCCTCAC
JMFS097D11+ CATTTCCTTTGTGTTGGTAGAGGGACCAATAGTGCAAACAATCTTAGTCTTACGCCTCAC
                      ____________________________________________________________
consensus CATTTCCTTTGTGTTGGTAGAGGGACCAATAGTGCAAACAATCTTAGTCTTACGCCTCAC
 
. : . : . : . : . : . :
JMSF047D04+ TATAGGTTTAGACCACATGCCCACTGATGTATCACCAAGTTGTTGAATTGCTTGTAGATA
JMFS164C09+ TATAGGTTTAGACCACATGCCCACTGATGTATCACCAAGTTGTTGAATTGCTTGTAGATA
JMFS097D11+ TATAGGTTTAGACCACATGCCCACTGATGTATCACCAAGTTGTTGAATTGCTTGTAGATA
                      ____________________________________________________________
consensus TATAGGTTTAGACCACATGCCCACTGATGTATCACCAAGTTGTTGAATTGCTTGTAGATA
 
. : . : . : . : . : . :
JMSF047D04+ CTGAACTTGCTCCTCACTCTTTGGAAAATCTTCAGGAGACACGGGAAGTATTTCGGTCTC
JMFS164C09+ CTGAACTTGCTCCTCACTCTTTGGAAAATCTTCAGGAGACACGGGAAGTATTTCGGTCTC
JMSF008P04+ GGTCTC
JMFS097D11+ CTGAACTTGCTCCTCACTCTTTGGAAAATCTTCAGGAGACACGGGAAGTATTTCGGTCTC
                      ____________________________________________________________
consensus CTGAACTTGCTCCTCACTCTTTGGAAAATCTTCAGGAGACACGGGAAGTATTTCGGTCTC
 
. : . : . : . : . : . :
JMSF047D04+ AGTGCGTGCAGATCTCTGGGCGCGGATTGGCGCCGCATTTAGCCGAACAGCTTTGTAACT
JMFS164C09+ AGTGCGTGCAGATCTCTGGGCGCGGATTGGCGCCGCATTTAGCCGAACAGCTTTGTAACT
JMSF008P04+ AGTGCGTGCAGATCTCTGGGCGCGGATNGGCGCCGCATTTAGCCGAACAGCTTTGTAACT
JMFS097D11+ AGTGCGTGCAGATCTCTGGGCGCGGATTGGCGCCGCATTTAGCCGAACAGCTTTGTAACT
                      ____________________________________________________________
consensus AGTGCGTGCAGATCTCTGGGCGCGGATTGGCGCCGCATTTAGCCGAACAGCTTTGTAACT
 
. : . : . : . : . : . :
JMSF047D04+ CTTGCTTCGCTCATTTCGAGCTAAGATTTTCGAGGCAAACCCAGATGGTTTGAGCTTCTC
JMFS164C09+ CTTGCTTCGCTCATTTCGAGCTAAGATTTTCGAGGCAAACCCAGATGGTTTGAGCTTCTC
JMSF008P04+ CTTGCTTCGCTCATTTCGAGCTAAGATTTTCGAGGCAAACCCAGATGGTTTGAGCTTCTC
JMFS097D11+ CTTGCTTCGCTCATTTCGAGCTAAGATTTTCGAGGCAAACCCAGATGGTTTGAGCTTCTC
                      ____________________________________________________________
consensus CTTGCTTCGCTCATTTCGAGCTAAGATTTTCGAGGCAAACCCAGATGGTTTGAGCTTCTC
 
. : . : . : . : . : . :
JMSF047D04+ GACTTGGCTCTGCAAGGATCCGGAGCTAGGGCTCGGGAATGAGCTCTGAACACACCGAGT
JMFS164C09+ GACTTGGCTCTGCAAGGATCCGGAGCTAGGGCTCGGGAATGAGCTCTGAACACACCGAGT
JMSF008P04+ GACTTGGCTCTGCAAGGATCCGGAGCTAGGGCTCGGGAATGAGCTCTGAACACACCGAGT
JMFS097D11+ GACTTGGCTCTGCAAGGATCCGGAGCTAGGGCTCGGGAATGAGCTCTGAACACACCGAGT
                      ____________________________________________________________
consensus GACTTGGCTCTGCAAGGATCCGGAGCTAGGGCTCGGGAATGAGCTCTGAACACACCGAGT
 
. : . : . : . : . : . :
JMSF047D04+ CGCCGCCACCACCTGAGCCATTCTTCGCCGGAGGTTATGGAAGGAGGTGAACTAGTGGAG
JMFS164C09+ CGCCGCCACCACCTGAGCCATTCTTCGCCGGAGGTTATGGAAGGAGGTGAACTAGTGGAG
JMSF008P04+ CGCCGCCACCACCTGAGCCATTCTTCGCCGGAGGTTATGGAAGGAGGTGAACTAGTGGAG
JMFS097D11+ CGCCGCCACCACCTGAGCCATTCTTCGCCGGAGGTTATGGAAGGAGGTGAACTAGTGGAG
                      ____________________________________________________________
consensus CGCCGCCACCACCTGAGCCATTCTTCGCCGGAGGTTATGGAAGGAGGTGAACTAGTGGAG
 
. : . : . : . : . : . :
JMSF047D04+ AAAAGCGATCGGAGAAACAAGAGTATAAATTGGAGCGAATG
JMFS164C09+ AAAAGCGATCGGAGAAACAAGAGTATAAATTGGAGCGAATGTGAGAAGCCTTGAAGAAAT
JMSF008P04+ AAAAGCGATCGGAGAAACAAGAGTATAAATTGGAGCGAATGTGAGAAGCCTTGAAGAAAT
JMFS097D11+ AAAAGCGATCGGAGAAACAAGAGTATAAATTGGAGCGAATGTGAGAAGCCTTGAAGAAAT
                      ____________________________________________________________
consensus AAAAGCGATCGGAGAAACAAGAGTATAAATTGGAGCGAATGTGAGAAGCCTTGAAGAAAT
 
. : . : . : . : . : . :
JMFS164C09+ CGCCGCTATGGTTAGCTGGAA
JMSF008P04+ CGCCGCTATGGTTAGCTGGAATGAGGCTTTGGC
JMFS097D11+ CGCCGCTATGGTTAGCTGGAATGAGGCTTTGGCTTCGTTTACATCGACGACTAGACGAGG
                      ____________________________________________________________
consensus CGCCGCTATGGTTAGCTGGAATGAGGCTTTGGCTTCGTTTACATCGACGACTAGACGAGG