Previous Contig 003653:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN007P15Sequence493003653 (3)
JMFS085B05Sequence620003653 (3)gb:AP003277_18270574e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMFS097D07Sequence615003653 (3)gb:AP003277_18270576e-22Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN007P15+ AGATATACAA
                      ____________________________________________________________
consensus AGATATACAA
 
. : . : . : . : . : . :
JMFN007P15+ TTCCCATATTATCATGCCAGAGACAAGACACTACAAGACCAGACCACATACTCATTGTCA
                      ____________________________________________________________
consensus TTCCCATATTATCATGCCAGAGACAAGACACTACAAGACCAGACCACATACTCATTGTCA
 
. : . : . : . : . : . :
JMFN007P15+ CCTAAACCTGAAGTTCCATAGCCATTTTACAGGCAATATCACAATACACCATAGAGAAAA
                      ____________________________________________________________
consensus CCTAAACCTGAAGTTCCATAGCCATTTTACAGGCAATATCACAATACACCATAGAGAAAA
 
. : . : . : . : . : . :
JMFN007P15+ AAACACCTAACATTCTTTAGTAGTGTTAGAATGCCATCGTTCACCTCTCCTCTCTTTGTC
                      ____________________________________________________________
consensus AAACACCTAACATTCTTTAGTAGTGTTAGAATGCCATCGTTCACCTCTCCTCTCTTTGTC
 
. : . : . : . : . : . :
JMFN007P15+ GTCAGCTCAGACTAAGGAACTTGGATGACCGAGTTTACTGATCCAAGAAAATGGTTGAAG
                      ____________________________________________________________
consensus GTCAGCTCAGACTAAGGAACTTGGATGACCGAGTTTACTGATCCAAGAAAATGGTTGAAG
 
. : . : . : . : . : . :
JMFN007P15+ CCATCAGCTCCTGAAGAAATGCTGCTCGCTTTCTCTTCTCCGCATAATCTTCCTCCCGAG
                      ____________________________________________________________
consensus CCATCAGCTCCTGAAGAAATGCTGCTCGCTTTCTCTTCTCCGCATAATCTTCCTCCCGAG
 
. : . : . : . : . : . :
JMFN007P15+ CTGGATCTGACAGATGCTGCTTGCTGCTTTGTGTATCAGTTGCAGTAGCAACATAGCAAG
JMFS085B05+ TGCTTTGTGTATCAGTTGCAGTAGCAACATAGCAAG
                      ____________________________________________________________
consensus CTGGATCTGACAGATGCTGCTTGCTGCTTTGTGTATCAGTTGCAGTAGCAACATAGCAAG
 
. : . : . : . : . : . :
JMFN007P15+ AATTGCTATCTTCTTGCACGGTTTCAGAATCCAAAGGAGGCACATTGGGAAGAAATGGCA
JMFS085B05+ AATTGCTATCTTCTTGCACGGTTTCAGAATCCAAAGGAGGCACATTGGGAAGAAATGGCA
JMFS097D07+ CATTGGGAAGAAATGGCA
                      ____________________________________________________________
consensus AATTGCTATCTTCTTGCACGGTTTCAGAATCCAAAGGAGGCACATTGGGAAGAAATGGCA
 
. : . : . : . : . : . :
JMFN007P15+ GCAGAAGTGGATCGGGAGCGGGTTCTTGCCCATTGAAATGACTGTTGATGACGTTAGAGC
JMFS085B05+ GCAGAAGTGGATCGGGAGCGGGTTCTTGCCCATTGAAATGACTGTTGATGACGTTAGAGC
JMFS097D07+ GCAGAAGTGGATCGGGAGCGGGTTCTTGCCCATTGAAATGACTGTTGATGACGTTAGAGC
                      ____________________________________________________________
consensus GCAGAAGTGGATCGGGAGCGGGTTCTTGCCCATTGAAATGACTGTTGATGACGTTAGAGC
 
. : . : . : . : . : . :
JMFN007P15+ CGG
JMFS085B05+ CGGTTAGATCTCGAAGGTCCCTGCCAATCATTGCTGCTGTGGCATTGTTCCAGAAGCCTG
JMFS097D07+ CGGTTAGATCTCGAAGGTCCCTGCCAATCATTGCTGCTGTGGCATTGTTCCAGAAGCCTG
                      ____________________________________________________________
consensus CGGTTAGATCTCGAAGGTCCCTGCCAATCATTGCTGCTGTGGCATTGTTCCAGAAGCCTG
 
. : . : . : . : . : . :
JMFS085B05+ ATTTTTGATACTTTCTCCTCCTCTTTACAGATTGTGCATGCTGTACGGTGAAATGACTGA
JMFS097D07+ ATTTTTGATACTTTCTCCTCCTCTTTACAGATTGTGCATGCTGTACGGTGAAATGACTGA
                      ____________________________________________________________
consensus ATTTTTGATACTTTCTCCTCCTCTTTACAGATTGTGCATGCTGTACGGTGAAATGACTGA
 
. : . : . : . : . : . :
JMFS085B05+ TAGGATCTTTCCCGAGAGTAGCAGCACATATGGGACAAACCGCGTTTTTCAAATCAAAGC
JMFS097D07+ TAGGATCTTTCCCGAGAGTAGCAGCACATATGGGACAAACCGCGTTTTTCAAATCAAAGC
                      ____________________________________________________________
consensus TAGGATCTTTCCCGAGAGTAGCAGCACATATGGGACAAACCGCGTTTTTCAAATCAAAGC
 
. : . : . : . : . : . :
JMFS085B05+ AGTGTTCTTCTTGC-AATGACTGCAAAGCACTGGAACTTCAATCTCTATGTAACAGAAAG
JMFS097D07+ AGTGTTCTTCTTGCAAATGACTGCAAAGCACTGGAACTTCAATCTCTATGTAACAGAAAG
                      ____________________________________________________________
consensus AGTGTTCTTCTTGCAAATGACTGCAAAGCACTGGAACTTCAATCTCTATGTAACAGAAAG
 
. : . : . : . : . : . :
JMFS085B05+ GGCAAGGAAACCAGGCCCTCAAATCTTCTGCTCCTTCATTTCCCATGTTCATGTAAGTGT
JMFS097D07+ GGCAAGGAAACCAGGCCCTCAAATCTTCTGCTCCTTCATTTCCCATGTTCATGTAAGTGT
                      ____________________________________________________________
consensus GGCAAGGAAACCAGGCCCTCAAATCTTCTGCTCCTTCATTTCCCATGTTCATGTAAGTGT
 
. : . : . : . : . : . :
JMFS085B05+ CTGCAGAACTGGTGACCCTGTTAGCTTGGACAGCAGAGTGGTGCTTTGTTGAGTGTACCC
JMFS097D07+ C---AGAACTGGTGACCCTGTTAGCTTGGACAGCAGAGTGGTGCTTTGTTGAGTGTACCC
                      ____________________________________________________________
consensus CTGCAGAACTGGTGACCCTGTTAGCTTGGACAGCAGAGTGGTGCTTTGTTGAGTGTACCC
 
. : . : . : . : . : . :
JMFS085B05+ TTGCAGCCCAAAAGTCTACATCCATTTCTGCAAATCCTCAAACTTGTTGGAAAATTAAAC
JMFS097D07+ TTGCAGCCCAAAAGTCTACATCCATTTCTGCAAATCCTCAAACTTGTTGGAAAATTAAAC
                      ____________________________________________________________
consensus TTGCAGCCCAAAAGTCTACATCCATTTCTGCAAATCCTCAAACTTGTTGGAAAATTAAAC
 
. : . : . : . : . : . :
JMFS085B05+ AGTGGGTCAGCTTGTATGGTGCTTGCTAGAGAATGGGGAAAGAAA
JMFS097D07+ AGTGGGTCAGCTTGTATGGTGCTTGCTAGAGAATGGGGAAAGAAATTGGTGAAGCAAATA
                      ____________________________________________________________
consensus AGTGGGTCAGCTTGTATGGTGCTTGCTAGAGAATGGGGAAAGAAATTGGTGAAGCAAATA
 
. : . : . : . : . : . :
JMFS097D07+ GTTGAGAAGATATCCAAATCTAAACAAGTTATAAGGTTGAGCTAAAAAGGAAGAGGAAGA
                      ____________________________________________________________
consensus GTTGAGAAGATATCCAAATCTAAACAAGTTATAAGGTTGAGCTAAAAAGGAAGAGGAAGA