Previous Contig 003650:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS007D02Sequence483003650 (5)pir|T52134|T521344e-09Zwille protein [imported] - Arabidopsis thaliana>gb:ART223508_1542068 Arabidopsi
JMFS068B05Sequence627003650 (5)pir|T52134|T521342e-09Zwille protein [imported] - Arabidopsis thaliana>gb:ART223508_1542068 Arabidopsi
JMFS097C07Sequence622003650 (5)pir|T52134|T521348e-09Zwille protein [imported] - Arabidopsis thaliana>gb:ART223508_1542068 Arabidopsi
JMFS110B11Sequence627003650 (5)pir|T52134|T521342e-09Zwille protein [imported] - Arabidopsis thaliana>gb:ART223508_1542068 Arabidopsi
JMFS169B09Sequence586003650 (5)pir|T52134|T521341e-09Zwille protein [imported] - Arabidopsis thaliana>gb:ART223508_1542068 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS169B09+ TAAA
                      ____________________________________________________________
consensus TAAA
 
. : . : . : . : . : . :
JMFS110B11+ GCCTGCATT
JMFS169B09+ GCCTTGAGCTTANCGCGAGGAAGGGAACCCCAAATCAAGATTACACATATTGCCTGCATT
                      ____________________________________________________________
consensus GCCTTGAGCTTANCGCGAGGAAGGGAACCCCAAATCAAGATTACACATATTGCCTGCATT
 
. : . : . : . : . : . :
JMFS110B11+ -TGAGCTGACCCATTGGGCAAAACAGCCTTCACCACAACAGCTTCACCTGCAGGCTGTGC
JMFS169B09+ NTGAGCTGACCCATTGGGCAAAACAGCCTTCACCACAACAGCTTCACCTGCAGGCTGTGC
JMFS007D02+ TTCACCTGCAGGCTGTGC
JMFS068B05+ CTTCACCACAACAGCTTCACCTGCAGGCTGTGC
JMFS097C07+ CAGCTTCACCTGCAGGCTGTGC
                      ____________________________________________________________
consensus NTGAGCTGACCCATTGGGCAAAACAGCCTTCACCACAACAGCTTCACCTGCAGGCTGTGC
 
. : . : . : . : . : . :
JMFS110B11+ TGCTATCACTGGCTTATGGGCAGCCGTGCAAGGCCTTGAACTTGGGCGCATAAAGGCCTC
JMFS169B09+ TGCTATCACTGGCTTATGGGCAGCCGTGCAAGGCCTTGAACTTGGGCGCATAAAGGCCTC
JMFS007D02+ TGCTATCACTGGCTTATGGGCAGCCGTGCAAGGCCTTGAACTTGGGCGCATAAAGGCCTC
JMFS068B05+ TGCTATCACTGGCTTATGGGCAGCCGTGCAAGGCCTTGAACTTGGGCGCATAAAGGCCTC
JMFS097C07+ TGCTATCACTGGCTTATGGGCAGCCGTGCAAGGCCTTGAACTTGGGCGCATAAAGGCCTC
                      ____________________________________________________________
consensus TGCTATCACTGGCTTATGGGCAGCCGTGCAAGGCCTTGAACTTGGGCGCATAAAGGCCTC
 
. : . : . : . : . : . :
JMFS110B11+ ACCTTGATCCGATTTCCGGCCACCCCTTCCCCTCCTCCGCCCCCTGTTCCGCCCCGGTGG
JMFS169B09+ ACCTTGATCCGATTTCCGGCCACCCCTTCCCCTCCTCCGCCCCCTGTTCCGCCCCGGTGG
JMFS007D02+ ACCTTGATCCGATTTCCGGCCACCCCTTCCCCTCCTCCGCCCCCTGTTCCGCCCCGGTGG
JMFS068B05+ ACCTTGATCCGATTTCCGGCCACCCCTTCCCCTCCTCCGCCCCCTGTTCCGCCCCGGTGG
JMFS097C07+ ACCTTGATCCGATTTCCGGCCACCCCTTCCCCTCCTCCGCCCCCTGTTCCGCCCCGGTGG
                      ____________________________________________________________
consensus ACCTTGATCCGATTTCCGGCCACCCCTTCCCCTCCTCCGCCCCCTGTTCCGCCCCGGTGG
 
. : . : . : . : . : . :
JMFS110B11+ GGGCGAAGTCTGCTCCTGTGTAGCTTTGCCACTCACCGGTTCTTGATTTGGTGGGCCTTT
JMFS169B09+ GGGCGAAGTCTGCTCCTGTGTAGCTTTGCCACTCACCGGTTCTTGATTTGGTGGGCCTTT
JMFS007D02+ GGGCGAAGTCTGCTCCTGTGTAGCTTTGCCACTCACCGGTTCTTGATTTGGTGGGCCTTT
JMFS068B05+ GGGCGAAGTCTGCTCCTGTGTAGCTTTGCCACTCACCGGTTCTTGATTTGGTGGGCCTTT
JMFS097C07+ GGGCGAAGTCTGCTCCTGTGTAGCTTTGCCACTCACCGGTTCTTGATTTGGTGGGCCTTT
                      ____________________________________________________________
consensus GGGCGAAGTCTGCTCCTGTGTAGCTTTGCCACTCACCGGTTCTTGATTTGGTGGGCCTTT
 
. : . : . : . : . : . :
JMFS110B11+ CCCACTCTGACCAGTCTTTGAGTTCTTCTGAGCTGCGTTCATGGCGTTCTGCAGCTGGGT
JMFS169B09+ CCCACTCTGACCAGTCTTTGAGTTCTTCTGAGCTGCGTTCATGGCGTTCTGCAGCTGGGT
JMFS007D02+ CCCACTCTGACCAGTCTTTGAGTTCTTCTGAGCTGCGTTCATGGCGTTCTGCAGCTGGGT
JMFS068B05+ CCCACTCTGACCAGTCTTTGAGTTCTTCTGAGCTGCGTTCATGGCGTTCTGCAGCTGGGT
JMFS097C07+ CCCACTCTGACCAGTCTTTGAGTTCTTCTGAGCTGCGTTCATGGCGTTCTGCAGCTGGGT
                      ____________________________________________________________
consensus CCCACTCTGACCAGTCTTTGAGTTCTTCTGAGCTGCGTTCATGGCGTTCTGCAGCTGGGT
 
. : . : . : . : . : . :
JMFS110B11+ TTTGATCACACAGTGCTGCTCTGATGTCTCCCTCATCTGCCTTATAGGCATGGCTATGGC
JMFS169B09+ TTTGATCACACAGTGCTGCTCTGATGTCTCCCTCATCTGCCTTATAGGCATGGCTATGGC
JMFS007D02+ TTTGATCACACAGTGCTGCTCTGATGTCTCCCTCATCTGCCTTATAGGCATGGCTATGGC
JMFS068B05+ TTTGATCACACAGTGCTGCTCTGATGTCTCCCTCATCTGCCTTATAGGCATGGCTATGGC
JMFS097C07+ TTTGATCACACAGTGCTGCTCTGATGTCTCCCTCATCTGCCTTATAGGCATGGCTATGGC
                      ____________________________________________________________
consensus TTTGATCACACAGTGCTGCTCTGATGTCTCCCTCATCTGCCTTATAGGCATGGCTATGGC
 
. : . : . : . : . : . :
JMFS110B11+ TATGGCTGCTACCCTTTCTTCCCCACTCAAAACTCCTATGAAAACCTCAAGAAAACACTG
JMFS169B09+ TATGGCTGCTACCCTTTCTTCCCCACTCAAAACTCCTATGAAAACCTCAAGAAAACACTG
JMFS007D02+ TATGGCTGCTACCCTTTCTTCCCCACTCAAAACTCCTATGAAAACCTCAAGAAAACACTG
JMFS068B05+ TATGGCTGCTACCCTTTCTTCCCCACTCAAAACTCCTATGAAAACCTCAAGAAAACACTG
JMFS097C07+ TATGGCTGCTACCCTTTCTTCCCCACTCAAAACTCCTATGAAAACCTCAAGAAAACACTG
                      ____________________________________________________________
consensus TATGGCTGCTACCCTTTCTTCCCCACTCAAAACTCCTATGAAAACCTCAAGAAAACACTG
 
. : . : . : . : . : . :
JMFS110B11+ GATTTCTCTCACTCTTTTCCTCTACTACCCTCCAAGATTTAAAGCAATTGGAACTGGAAA
JMFS169B09+ GATTTCTCTCACTCTTTTCCTCTACTACCCTCCAAGATTTAAAGCAATTGGAACTGGAAA
JMFS007D02+ GATTTCTCTCACTCTTTTCCTCTACTACCCTCCAAGATTTAAAGCAATTGGAACTGGAAA
JMFS068B05+ GATTTCTCTCACTCTTTTCCTCTACTACCCTCCAAGATTTAAAGCAATTGGAACTGGAAA
JMFS097C07+ GATTTCTCTCACTCTTTTCCTCTACTACCCTCCAAGATTTAAAGCAATTGGAACTGGAAA
                      ____________________________________________________________
consensus GATTTCTCTCACTCTTTTCCTCTACTACCCTCCAAGATTTAAAGCAATTGGAACTGGAAA
 
. : . : . : . : . : . :
JMFS110B11+ TC
JMFS169B09+ TCCC
JMFS007D02+ TCCC
JMFS068B05+ TCCCATGAATGGACCATAAAGGGGTTATATGAAGCTTTAGAGAAAGCAGTATCTTCCTGA
JMFS097C07+ TCCCATGAATGGACCATAAAGGGGTTATATGAAGCTTTAGAGAAAGCAGTATCTTCCTGA
                      ____________________________________________________________
consensus TCCCATGAATGGACCATAAAGGGGTTATATGAAGCTTTAGAGAAAGCAGTATCTTCCTGA
 
. : . : . : . : . : . :
JMFS068B05+ TTCAAAGCACCGCAAAAACTGTGGCTTTAGAGAAAGAGAGAGGGGGAAGGTGTATGGCTC
JMFS097C07+ TTCAAAGCACCGCAAAAACTGTGGCTTTAGAGAAAGAGAGAGGGGGAAGGTGTATGGCTC
                      ____________________________________________________________
consensus TTCAAAGCACCGCAAAAACTGTGGCTTTAGAGAAAGAGAGAGGGGGAAGGTGTATGGCTC
 
. : . : . : . : . : . :
JMFS068B05+ AAAAGATGGGACTGAAGGAGAATCGTGAATGGCTTTGAAAGTTGAGAGATGTAA
JMFS097C07+ AAAAGATGGGACTGAAGGAGAATCGTGAGTGGCTTTGAAAGTTGAGAGATGTAAAGATAA
                      ____________________________________________________________
consensus AAAAGATGGGACTGAAGGAGAATCGTGAGTGGCTTTGAAAGTTGAGAGATGTAAAGATAA