Previous Contig 003645:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002H16Sequence523003645 (187)sp|P04715|RBS2_PETHY5e-66Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 657003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF008D15Sequence611003645 (187)sp|P04715|RBS2_PETHY5e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 102003645 (187)
JMFF016K14Sequence633003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF020O01Sequence168003645 (187)sp|P26574|RBS1_SOLTU8e-09Ribulose bisphosphate carboxylase small chain 1, chloroplast precursor (EC 4.1.1
JMFF022K10Sequence488003645 (187)sp|P04715|RBS2_PETHY2e-59Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 601003645 (187)sp|P04715|RBS2_PETHY6e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF022M24Sequence462003645 (187)sp|P04715|RBS2_PETHY7e-56Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 700003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF023C22Sequence663003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF023P10Sequence601003645 (187)sp|P04715|RBS2_PETHY6e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF027F21Sequence524003645 (187)sp|P04715|RBS2_PETHY2e-65Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 662003645 (187)sp|P04715|RBS2_PETHY9e-68Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF028L01Sequence570003645 (187)sp|P04715|RBS2_PETHY4e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 636003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF032I12Sequence246003645 (187)sp|Q9XGX5|RBS2_AMAHP0.025Ribulose bisphosphate carboxylase small chain 2, chloroplast precursor (EC 4.1.1206003645 (187)sp|Q9XGX5|RBS2_AMAHP0.024Ribulose bisphosphate carboxylase small chain 2, chloroplast precursor (EC 4.1.1
JMFF043G15Sequence636003645 (187)sp|P04715|RBS2_PETHY2e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 611003645 (187)sp|P04715|RBS2_PETHY2e-66Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFF043O24Sequence642003645 (187)sp|P04715|RBS2_PETHY1e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 572003645 (187)sp|P04715|RBS2_PETHY2e-65Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN001D01Sequence527003645 (187)sp|P04715|RBS2_PETHY2e-68Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN002G11Sequence515003645 (187)sp|P04715|RBS2_PETHY4e-69Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN003I19Sequence587003645 (187)sp|P04715|RBS2_PETHY4e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN003L11Sequence625003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN003L19Sequence636003645 (187)sp|P04715|RBS2_PETHY4e-77Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN003P17Sequence634003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN004D18Sequence618003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN004E21Sequence516003645 (187)sp|P04715|RBS2_PETHY3e-55Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN004G04Sequence556003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN004I21Sequence611003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN004M08Sequence252003645 (187)gb:TOMRBCSE_17257034e-06Tomato RuBP carboxylase small subunit LESS5 mRNA.
JMFN004N06Sequence538003645 (187)sp|P04715|RBS2_PETHY1e-60Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN004O16Sequence627003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN004P04Sequence616003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN005B03Sequence617003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN005F15Sequence492003645 (187)sp|P04715|RBS2_PETHY1e-51Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN006I12Sequence642003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN007B02Sequence625003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN007G17Sequence640003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN008B24Sequence642003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN008G07Sequence560003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN008J16Sequence616003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN008O03Sequence627003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN008P04Sequence635003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN009E07Sequence445003645 (187)sp|P04715|RBS2_PETHY6e-44Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN009G13Sequence626003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN009I01Sequence600003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN009K18Sequence616003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN011D02Sequence607003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN011E08Sequence610003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN011E22Sequence640003645 (187)sp|P04715|RBS2_PETHY5e-77Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN011H13Sequence629003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN011O10Sequence606003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN014J22Sequence651003645 (187)sp|P04715|RBS2_PETHY2e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN014P18Sequence634003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN015B04Sequence607003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN015F07Sequence617003645 (187)sp|P04715|RBS2_PETHY2e-69Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN015J13Sequence619003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN015K19Sequence617003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN015N15Sequence630003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN015N23Sequence620003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN016A16Sequence608003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN016F09Sequence613003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN016G01Sequence628003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN016L16Sequence537003645 (187)sp|P04715|RBS2_PETHY4e-54Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN016M10Sequence612003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN016P02Sequence627003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN018B02Sequence610003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN018C05Sequence633003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN019D08Sequence612003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN019E13Sequence623003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN019O10Sequence642003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN020F09Sequence642003645 (187)sp|P04715|RBS2_PETHY1e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN020M01Sequence610003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN025C24Sequence620003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN025D20Sequence619003645 (187)sp|P04715|RBS2_PETHY4e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN025E19Sequence627003645 (187)sp|P04715|RBS2_PETHY2e-69Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN025H08Sequence657003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN025I18Sequence618003645 (187)sp|P04715|RBS2_PETHY2e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN025K16Sequence513003645 (187)sp|P04715|RBS2_PETHY8e-68Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN025K18Sequence647003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN028H10Sequence360003645 (187)sp|P17673|RBS_TRIRP2e-33Ribulose bisphosphate carboxylase small chain, chloroplast precursor (EC 4.1.1.3
JMFN028J06Sequence299003645 (187)sp|P04715|RBS2_PETHY4e-29Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN028M12Sequence488003645 (187)sp|P04715|RBS2_PETHY5e-53Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN028P07Sequence644003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN029L04Sequence600003645 (187)sp|P04715|RBS2_PETHY1e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN029L20Sequence612003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN030D12Sequence155003645 (187)sp|P26577|RBSC_SOLTU9e-10Ribulose bisphosphate carboxylase small chain 2C, chloroplast precursor (EC 4.1.
JMFN030E16Sequence625003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN031C21Sequence641003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN031H21Sequence638003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN032G08Sequence629003645 (187)sp|P04715|RBS2_PETHY2e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN033G13Sequence623003645 (187)sp|P04715|RBS2_PETHY5e-62Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN033H22Sequence640003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN033N11Sequence637003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN033N15Sequence653003645 (187)sp|P04715|RBS2_PETHY2e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN034F06Sequence616003645 (187)sp|P04715|RBS2_PETHY1e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN034H06Sequence603003645 (187)sp|P04715|RBS2_PETHY2e-50Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN035C01Sequence466003645 (187)sp|P04715|RBS2_PETHY9e-48Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN035M13Sequence587003645 (187)sp|P04715|RBS2_PETHY1e-65Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN035O07Sequence643003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN036P01Sequence584003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN037P21Sequence614003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN038A18Sequence632003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN038C17Sequence612003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN038H15Sequence613003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN038O04Sequence628003645 (187)sp|P04715|RBS2_PETHY2e-77Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN038P11Sequence610003645 (187)sp|P04715|RBS2_PETHY5e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN039D12Sequence595003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN039E16Sequence614003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN039H16Sequence621003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN039L12Sequence634003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN040E09Sequence632003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN040F16Sequence629003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN040H12Sequence619003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN041J04Sequence629003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN042J10Sequence446003645 (187)sp|P04715|RBS2_PETHY2e-55Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN042J11Sequence631003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN042M08Sequence613003645 (187)sp|P04715|RBS2_PETHY3e-65Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN043G17Sequence616003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN046A08Sequence617003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFN046J18Sequence513003645 (187)sp|P04715|RBS2_PETHY4e-70Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFS036B10Sequence580003645 (187)sp|P04715|RBS2_PETHY8e-70Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFS050F10Sequence499003645 (187)sp|P04715|RBS2_PETHY1e-50Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFS097A04Sequence611003645 (187)sp|P04715|RBS2_PETHY7e-57Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFS100G06Sequence625003645 (187)sp|P04715|RBS2_PETHY3e-57Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMFS160H07Sequence535003645 (187)sp|P04715|RBS2_PETHY1e-71Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF003N03Sequence327003645 (187)sp|P04715|RBS2_PETHY8e-27Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 647003645 (187)sp|P04715|RBS2_PETHY2e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF005C17Sequence300003645 (187)gb:AY220079_15904256e-22Nicotiana tabacum putative ribulose bisphosphate carboxylase small subunit prote
JMSF005C19Sequence426003645 (187)sp|P04715|RBS2_PETHY1e-45Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF006H10Sequence457003645 (187)sp|P04715|RBS2_PETHY7e-55Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF006H12Sequence273018474sp|Q9LSP0|PE29_ARATH4e-12Peroxidase 29 precursor (EC 1.11.1.7) (Atperox P29) (ATP40).>gb:AY085510_1570579571003645 (187)sp|P04715|RBS2_PETHY3e-70Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF006L10Sequence441003645 (187)sp|P04715|RBS2_PETHY3e-54Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 508003645 (187)sp|P04715|RBS2_PETHY3e-63Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF010G13Sequence455003645 (187)sp|P04715|RBS2_PETHY1e-49Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 645003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF011P07Sequence226003645 (187)sp|P04715|RBS2_PETHY2e-09Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 649003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF013I05Sequence566003645 (187)sp|P04715|RBS2_PETHY3e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 637003645 (187)sp|P04715|RBS2_PETHY2e-72Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF013P01Sequence410003645 (187)sp|P04715|RBS2_PETHY1e-43Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 658003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF016C06Sequence406003645 (187)sp|P04715|RBS2_PETHY6e-43Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 693003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF016D23Sequence246003645 (187)sp|P04715|RBS2_PETHY8e-14Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 687003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF016H24Sequence241003645 (187)gb:AY220079_15904253e-13Nicotiana tabacum putative ribulose bisphosphate carboxylase small subunit prote669003645 (187)sp|P04715|RBS2_PETHY2e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF016J17Sequence474003645 (187)sp|P04715|RBS2_PETHY5e-57Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 711003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF016M12Sequence479003645 (187)sp|P04715|RBS2_PETHY5e-58Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 712003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF016N22Sequence474003645 (187)sp|P04715|RBS2_PETHY2e-56Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 651003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF022L22Sequence654003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 676003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF028A12Sequence694003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 672003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF028D05Sequence634000646 (18)pir|H84722|H847225e-90hypothetical protein At2g31610 [imported] - Arabidopsis thaliana>gb:AC007071_153667003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF029D04Sequence682003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 606003645 (187)sp|P04715|RBS2_PETHY4e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF029H18Sequence582003645 (187)sp|P04715|RBS2_PETHY2e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 699003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF031E10Sequence477002817 (3)gb:AP005514_18532492e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN693003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF031M19Sequence615003645 (187)sp|P04715|RBS2_PETHY2e-74Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 608003645 (187)sp|P04715|RBS2_PETHY4e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF031M20Sequence117003645 (187)
JMSF037F13Sequence533002817 (3)gb:AP005514_18532493e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJN691003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF039L23Sequence707003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 711003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF039O13Sequence606003645 (187)sp|P04715|RBS2_PETHY3e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 602013255 (2)gb:MTR238212_16876072e-06Medicago truncatula mRNA for glutamine synthetase I.
JMSF040L23Sequence679003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 715003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF042N10Sequence738003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 660003645 (187)sp|P04715|RBS2_PETHY5e-73Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF044G04Sequence234020249696003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF046O15Sequence688003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 629003645 (187)sp|P04715|RBS2_PETHY1e-76Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF049G13Sequence705003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 667003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF051L03Sequence614003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 712003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC
JMSF051P07Sequence686003645 (187)sp|P04715|RBS2_PETHY4e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC 710003645 (187)sp|P04715|RBS2_PETHY5e-75Ribulose bisphosphate carboxylase small chain SSU11A, chloroplast precursor (EC

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN034H06- GAGAGAGAACTAGTCTCGAGXXXXXXXXXXXXXXXXXXGTGG
                      ____________________________________________________________
consensus GAGAGAGAACTAGTCTCGAGNNNNNNNNNNNNNNNNNNGTGG
 
. : . : . : . : . : . :
JMFN034H06- TTAGAGATAAGATAAGGAGTGATGAATTGGAACATACAAGCTAAGAGAATTGAAGGAACA
                      ____________________________________________________________
consensus TTAGAGATAAGATAAGGAGTGATGAATTGGAACATACAAGCTAAGAGAATTGAAGGAACA
 
. : . : . : . : . : . :
JMFS050F10+ GCACAACCAAATGAAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
JMFN004M08+ GAAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
JMFN034H06- TTGCACAACCAAATGAAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
JMFN016L16+ AAACAACAGCAAATTCAAAGGATTATTACAATATATCATTCTCAT
JMFN035C01+ GAAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
JMFN004N06+ GAAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
JMFN042M08- AAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
rJMFF043O24- TTCAAAGGATTATTACAATATTACATTCTCAT
JMFN004E21+ AAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
JMFN005F15+ AACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
JMFN009E07+ AACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
rJMFF032I12- AAGGATTATTACAATATTACATTCTCAT
JMFF032I12+ AAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
JMFN035M13- GAAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
rJMSF037F13- TTCTCAT
rJMSF031E10- ATTCTCAT
rJMSF028D05- AAGGATTATTACAATATTACATTCTCAT
JMFN003L19+ ACAATATTACATTCTCAT
rJMFF023C22- GATTATTACAATATTACATTCTCAT
rJMSF016N22- ATATTACATTCTCAT
rJMSF013P01- CATATTACATTCTCAT
JMFN007G17+ CATTCTCAT
rJMSF005C19- CATATTACATTCTCAT
rJMFF002H16- CATATTACATTCTCAT
rJMSF042N10- CATATTACATTCTCAT
rJMSF011P07- CATTCTCAT
rJMFF027F21- GGATTATTAC-ATATTACATTCTCAT
rJMSF010G13- ATTCTCAT
rJMSF003N03- TTCTCAT
JMFN008B24+ CTCAT
rJMSF046O15- TATTACATTCTCAT
rJMFF043G15- TTATTACAATATTACATTCTCAT
JMSF042N10+ AACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
rJMSF040L23- ATTACATTCTCAT
rJMSF039L23- CATTCTCAT
rJMSF051P07- ATTCTCAT
rJMSF051L03- ATTCTCAT
JMSF039L23+ CTCAT
JMSF049G13+ CAT
rJMSF016M12- ATTCTCAT
JMSF028A12+ CAT
JMFN038O04+ CAT
rJMSF016J17- TTCTCAT
                      ____________________________________________________________
consensus TTGCACAACCAAATGAAACAACAGCAAATTCAAAGGATTATTACAATATTACATTCTCAT
 
. : . : . : . : . : . :
JMFS050F10+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN004M08+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN034H06- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN016L16+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN035C01+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN004N06+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN042M08- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMFF043O24- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN004E21+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN005F15+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN009E07+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMFF032I12- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMFF008D15- T-GTGACCGAAATCNAAAAACA
JMFF032I12+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN035M13- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF037F13- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF031E10- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF028D05- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN003L19+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMFF023C22- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF016N22- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF013P01- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACATGGTGACCGAAATCGAAAAACA
JMFN007G17+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN025D20+ GAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF006L10- GGATTGGGAATCCATTCCATGCCAAAAACAACAT-GTGACCGAAATCGAAAAACA
JMFN004O16+ TGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF005C19- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMFF002H16- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF042N10- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF011P07- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF006H12- AACAT-GTGACCGAAATCGAAAAACA
rJMFF027F21- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF010G13- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF003N03- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN008B24+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMFF028L01- AACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF013I05- AACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF046O15- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMFF043G15- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMSF042N10+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF040L23- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF039L23- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF051P07- AAACTGGATTGGGAATCCATTCCATGCCA--AACAACAT-GTGACCGAAATCGAAAAACA
rJMSF051L03- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMSF039L23+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF049G13- ACAT-GTGACCGAAATCGAAAAACA
JMSF049G13+ AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF044G04- TTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF029H18- GATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMSF040L23+ ATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF016M12- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCAAAAAACA
JMFN031C21+ ACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN028P07+ CCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN025K18+ ATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN033N15+ TGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN035O07+ GAAATCGAAAAACA
JMFN019O10+ CCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN015N15+ CAACAACAT-GTGACCGAAATCGAAAAACA
JMFN039H16+ CGAAATCGAAAAACA
JMFN015J13+ TCGAAAAACA
JMFN006I12+ CCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN020F09+ ATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN014J22+ TCCATGCCAACANCAACAT-GTGACCGAAATCGAAAAACA
JMFN025H08+ TGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCG-AAAACA
JMFN032G08+ A
JMFN025I18+ CA
JMFN015K19+ A
JMFN038H15+ CA
JMFN040H12+ CA
JMFN008P04+ AAAACA
JMFN041J04+ AAAAACA
JMFN019E13+ GAAAAACA
JMFN014P18+ ATCGAAAAACA
JMFN033N11+ ACAT-GTGACCGAAATCGAAAAACA
JMFN042J11+ AAATCGAAAAACA
JMFN040E09+ GAAATCGAAAAACA
JMFN030E16+ AATCGAAAAACA
JMFN018C05+ CGAAATCGAAAAACA
JMFN031H21+ CGAAATCGAAAAACA
JMFN011E22+ AATCGAAAAACA
rJMFF022M24- AACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF028A12- TTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMSF028A12+ AAACTGGANTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFF043O24+ A
rJMSF016C06- TGGGAACCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF016H24- ACAACAT-GTGACCGAAATCGAAAAACA
JMSF029D04+ TTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN033H22+ GAAATCGAAAAACA
JMFN039L12+ CGAAATCGAAAAACA
JMFN038A18+ GAAATCGAAAAACA
JMFN004I21+ A
JMFN003P17+ CGAAATCGAAAAACA
JMFN003L11+ ATCGAAAAACA
JMFN038O04+ AAACTGGA-TGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMFN016G01+ CGAAATCGAAAAACA
JMFN004D18+ ATCGAAAAACA
JMFN025E19+ CGAAATCGAAAAACA
JMFN019D08+ CA
JMFN040F16+ CCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
rJMSF016J17- AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMSF051P07+ CCATTCCATGCCA--AACAACAT-GTGACCGAAATCGAAAAACA
rJMSF022L22- ACAACATGGTGACCGAAATCGAAAAACA
rJMSF031M19- ACAACATGGTGACCGAAATCGAAAAACA
rJMSF029D04- ACATGGTGACCGAAATCGAAAAACA
rJMSF016D23- GCCAACAACAACATGGTGACCGAAATCGAAAAACA
JMFN016P02+ CGAAAAACA
JMSF046O15+ CCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
JMSF022L22+ CGAAAAACA
                      ____________________________________________________________
consensus AAACTGGATTGGGAATCCATTCCATGCCAACAACAACAT-GTGACCGAAATCGAAAAACA
 
. : . : . : . : . : . :
JMFS050F10+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN004M08+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN034H06- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN016L16+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN035C01+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN004N06+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN042M08- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF043O24- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN004E21+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN005F15+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN009E07+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF032I12- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF008D15- AAAGAGNAGATTAATGGGAAATCNTC-CATCATTTAAGGAAATTGGGGGATGGAATCCTA
JMFF032I12+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN035M13- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF037F13- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF031E10- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF028D05- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN003L19+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF023C22- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF016N22- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF013P01- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN007G17+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN025D20+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF006L10- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN004O16+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF005C19- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF002H16- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF042N10- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF011P07- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF006H12- GAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF027F21- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF010G13- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF003N03- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN008B24+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF028L01- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF013I05- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF046O15- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN029L20+ ATGGGAAATCATC-CATCATTAAGGGAAATTGGGGGATGGAAT-CTA
JMSF039O13- C-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF043G15- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF042N10+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF040L23- AAAGACCAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF039L23- AAAGACCAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF051P07- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF051L03- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF039L23+ AAAGACCAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF049G13- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF049G13+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF044G04- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF029H18- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF040L23+ AAAGACCAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF016M12- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN031C21+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN028P07+ AAAGACAAGATTAATGGGAAATCATC-CATCATCTAAGGAAATTGGGGGATGGAAT-CTA
JMFN025K18+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN033N15+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN035O07+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN019O10+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN015N15+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN039H16+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN015J13+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN006I12+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN020F09+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGNGGATGGAAT-CTA
JMFN014J22+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN025H08+ AAAGACAAGATTAAT-GGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN032G08+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN025I18+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN015K19+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGNGGATGGAAT-CTA
JMFN038H15+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN040H12+ AAAGACAAGATTAATGGGAAATCATC-CATCATTACAGGAAATTGGGGGATGGAAT-CTA
JMFN008P04+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN041J04+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN019E13+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN014P18+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN033N11+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN042J11+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN040E09+ AAAGACAAGATTAATGGGAAATCATC-CATCATTNAAGGAAATTGGGGGATGGAAT-CTA
JMFN030E16+ AAAGACAAGATTAATGGGAAATCATC-TATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN018C05+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN008O03+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN009G13+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN007B02+ AGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN025C24+ GATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN043G17+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN046A08+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN016F09+ CAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN037P21+ GATTAATGGGAAATCATC-CATCATTNAAGGAAATTGGGGGATGGAAT-CTA
JMFN015F07+ TTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN016A16+ TTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN039E16+ GATTAATGGGAAATCATC-CATCATTNAAGGAAATTGGGGGATGGAAT-CTA
JMFN015B04+ GGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN011O10+ ATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN009I01+ GGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN039D12+ TCATC-CATCATTTAAGGAAATGGGGGGATGGAAT-CTA
rJMSF031M20- TC-CATCATTTAGGGAAATTGGGGGATGGAAT-CTA
JMFN029L04+ TGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN036P01+ GGAAATTGGGGGATGGAAT-CTA
JMFN011H13+ T-CTA
rJMFF020O01- TGGGAAATCATC-CATCATTTANGGAAATTGGGGGATGGAAT-CTA
JMFF016K14+ CAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN031H21+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGNATGGAAT-CTA
JMFN011E22+ AAAGCCAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF022M24- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF028A12- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF028A12+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFF043G15+ CAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFF043O24+ AAAGACAAGATTAATGGGAAATCATC-CATCATTNAAGGAAATTGGGGGATGGAAT-CTA
rJMSF016C06- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF016H24- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF029D04+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN033H22+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN039L12+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN038A18+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN004I21+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN003P17+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN015N23+ GATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN003L11+ AAAGACAAGATTAATGGGAAATCACT-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN038O04+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN016G01+ AAAGACAGANTTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN005B03+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN008J16+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN009K18+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN004D18+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN025E19+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN004P04+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGNGGATGGAAT-CTA
JMFN034F06+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN016M10+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN019D08+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN018B02+ GATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN038C17+ AAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFN040F16+ AAAGACAAGATTAATGGGAAATCATC-CATCATNTAAGGAAATTGGGGGATGGAAT-CTA
JMFF008D15+ TAAGGAAATTGGGGGATGGAAT-CTA
JMFN011D02+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN011E08+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGNGGATGGAAT-CTA
JMFN038P11+ AAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN020M01+ GATTAATGGG-AATCATCNCATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN003I19+ ATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF016J17- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF051P07+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF022L22- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF031M19- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF029D04- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMSF016D23- AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMFN016P02+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF051L03+ TTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF046O15+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
JMSF031M19+ ATTTAAGGAAATTGGGGGATGGAAT-CTA
rJMFF023P10- ATTGGGGGATGGAAT-CTA
rJMFF022K10- ATTGGGGGATGGAAT-CTA
JMSF022L22+ AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
                      ____________________________________________________________
consensus AAAGACAAGATTAATGGGAAATCATC-CATCATTTAAGGAAATTGGGGGATGGAAT-CTA
 
. : . : . : . : . : . :
JMFS050F10+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN004M08+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN034H06- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN016L16+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN035C01+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN004N06+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN042M08- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF043O24- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN004E21+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN005F15+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN009E07+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF032I12- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF008D15- TTTATCNTC-GGGCTTGTATGC-A
JMFF032I12+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN035M13- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF037F13- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF031E10- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF028D05- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN003L19+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF023C22- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF016N22- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF013P01- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN007G17+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN025D20+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF006L10- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN004O16+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF005C19- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF002H16- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF042N10- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF011P07- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF006H12- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF027F21- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF010G13- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF003N03- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN008B24+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF028L01- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF013I05- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF046O15- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN029L20+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF039O13- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF043G15- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF042N10+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF040L23- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF039L23- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF051P07- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF051L03- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF039L23+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF049G13- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF049G13+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF044G04- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF029H18- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF040L23+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF016M12- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN031C21+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN028P07+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN025K18+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN033N15+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN035O07+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN019O10+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN015N15+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGAACTTGGCGCTTGTTGT
JMFN039H16+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN015J13+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN006I12+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN020F09+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN014J22+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN025H08+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN032G08+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGAGCTTGTTGT
JMFN025I18+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN015K19+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN038H15+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN040H12+ TNTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN008P04+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN041J04+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN019E13+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN014P18+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN033N11+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN042J11+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN040E09+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN030E16+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN018C05+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN008O03+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN009G13+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN007B02+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN025C24+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN043G17+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN046A08+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TAATGCA-CTGCACTTGGCGCTTGTTGT
JMFN016F09+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN037P21+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN015F07+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN016A16+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN039E16+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN015B04+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN011O10+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN009I01+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN039D12+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF031M20- TTTATCATGGAGGCTTGTATGCGNATGAACAGTGATGCANATGCACTTGGCGCTTGTTGT
JMFN029L04+ TTTATCATCGGGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN036P01+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN011H13+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN008G07+ TCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFS036B10+ ATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTG-TGT
JMFS160H07+ TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN001D01+ GGCGCTTGTTGT
JMFN002G11+ CTTGGCGCTTGTTGT
JMFN046J18+ CTGCACTTGGCGCTTGTTGT
JMFN025K16+ GCGCTTGTTGT
JMFN033G13+ TTGT
rJMFF020O01- TTTATCATC-GGGNTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGNCNCTNGTTGT
JMFF016K14+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN031H21+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN011E22+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF022M24- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF028A12- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF028A12+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFF043G15+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFF043O24+ TTNATCATC-GGGCTNGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFF028L01+ TTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF016C06- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF016H24- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF029D04+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN033H22+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN039L12+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN038A18+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN004I21+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN003P17+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN015N23+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN003L11+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN038O04+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN016G01+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN005B03+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN008J16+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN009K18+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN004D18+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN025E19+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN004P04+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN034F06+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN016M10+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN019D08+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN018B02+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN038C17+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN040F16+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFF008D15+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN011D02+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN011E08+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN038P11+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN020M01+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN003I19+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF013I05+ GTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN004G04+ TCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF016J17- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF051P07+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF022L22- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF031M19- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF029D04- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMSF016D23- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMFN016P02+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF051L03+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF046O15+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF031M19+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF023P10- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
rJMFF022K10- TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF029H18+ CATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
JMSF022L22+ TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
                      ____________________________________________________________
consensus TTTATCATC-GGGCTTGTATGC-AATGAACA-TGATGCA-CTGCACTTGGCGCTTGTTGT
 
. : . : . : . : . : . :
JMFS050F10+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN004M08+ CGAATCCCAGGATTCTAACCCACGCACCAGGGT
JMFN034H06- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN016L16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN035C01+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN004N06+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN042M08- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF043O24- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN004E21+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN005F15+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN009E07+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF032I12- CGAAT
JMFF032I12+ CGAAT
JMFN035M13- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF037F13- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF031E10- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF028D05- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN003L19+ CGAATCCCAGGATTCTAATCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF023C22- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF016N22- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF013P01- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN007G17+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN025D20+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF006L10- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN004O16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF005C19- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF002H16- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF042N10- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF011P07- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF006H12- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF027F21- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF010G13- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF003N03- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN008B24+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF028L01- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF013I05- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF046O15- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN029L20+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF039O13- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF043G15- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF042N10+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF040L23- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF039L23- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF051P07- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF051L03- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF039L23+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF049G13- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF049G13+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF044G04- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF029H18- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF040L23+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF016M12- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN031C21+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN028P07+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN025K18+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN033N15+ CGAATCCCAGGATTCTAACCTACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN035O07+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN019O10+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN015N15+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN039H16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN015J13+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN006I12+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN020F09+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN014J22+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN025H08+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN032G08+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN025I18+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN015K19+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN038H15+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN040H12+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN008P04+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN041J04+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN019E13+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN014P18+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN033N11+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN042J11+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN040E09+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN030E16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN018C05+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN008O03+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN009G13+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN007B02+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN025C24+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN043G17+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN046A08+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN016F09+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN037P21+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN015F07+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN016A16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN039E16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN015B04+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN011O10+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN009I01+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN039D12+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF031M20- CGAATCCCAGGATTCTAACCCAC
JMFN029L04+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN036P01+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN011H13+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN008G07+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCTAGCTCCG
JMFS036B10+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFS160H07+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN001D01+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN002G11+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN046J18+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN025K16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN033G13+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF020O01- CCAATCCCNNGATTCTAACCCACNCACCAGGGTAANCCTTCTTGCACTCCTCCAGCTCCG
JMFF016K14+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN031H21+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN011E22+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF022M24- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF028A12- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF028A12+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFF043G15+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFF043O24+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFF028L01+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN028M12+ ATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN042J10+ CG
JMFF002H16+ TCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFF027F21+ ATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF016C06- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF016H24- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF029D04+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN033H22+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN039L12+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN038A18+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN004I21+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN003P17+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN015N23+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN003L11+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN038O04+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN016G01+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN005B03+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN008J16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN009K18+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN004D18+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCTTCCAGCTCCG
JMFN025E19+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN004P04+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN034F06+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN016M10+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN019D08+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN018B02+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN038C17+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN040F16+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFF008D15+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN011D02+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN011E08+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN038P11+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN020M01+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN003I19+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF013I05+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN004G04+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCTAGCTCCG
rJMSF016J17- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF051P07+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF022L22- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF031M19- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF029D04- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMSF016D23- CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFN016P02+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF051L03+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF046O15+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF031M19+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF023P10- CGAATCCCAGGATTCTAACCCACGCACCAGGCTAAGCCTTCTTGCACTCCTCCAGCTCCG
rJMFF022K10- CGAATCCCAGGATTCTAACCCACGCACCAGGCTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF029H18+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFF022K10+ TCTTGCACTCCTCCAGCTCCG
JMSF022L22+ CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMSF016M12+ CAGCTCCG
JMSF016N22+ CCG
JMSF016J17+ CCG
JMFS100G06+ CAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
JMFS097A04+ TTGCACTCCTCCAGCTCCG
                      ____________________________________________________________
consensus CGAATCCCAGGATTCTAACCCACGCACCAGGGTAAGCCTTCTTGCACTCCTCCAGCTCCG
 
. : . : . : . : . : . :
JMFS050F10+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN034H06- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN016L16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN035C01+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN004N06+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN042M08- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF043O24- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN004E21+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN005F15+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN009E07+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN035M13- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF037F13- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF031E10- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF028D05- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN003L19+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF023C22- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF016N22- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF013P01- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN007G17+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN025D20+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF006L10- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN004O16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF005C19- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF002H16- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF042N10- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF011P07- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF006H12- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF027F21- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF010G13- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF003N03- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN008B24+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF028L01- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF013I05- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF046O15- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN029L20+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF039O13- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF043G15- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF042N10+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF040L23- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF039L23- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF051P07- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF051L03- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF039L23+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF049G13- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF049G13+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF044G04- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF029H18- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF040L23+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF016M12- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN031C21+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN028P07+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN025K18+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN033N15+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN035O07+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN019O10+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN015N15+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN039H16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN015J13+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN006I12+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN020F09+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN014J22+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN025H08+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN032G08+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN025I18+ CAACCACNTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN015K19+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN038H15+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN040H12+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN008P04+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN041J04+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN019E13+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN014P18+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN033N11+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN042J11+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN040E09+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN030E16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN018C05+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN008O03+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN009G13+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN007B02+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN025C24+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN043G17+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN046A08+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN016F09+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN037P21+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN015F07+ CAACCACCTGAGTCG-GTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN016A16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN039E16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN015B04+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN011O10+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN009I01+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN039D12+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN029L04+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN036P01+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN011H13+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN008G07+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFS036B10+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFS160H07+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN001D01+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN002G11+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN046J18+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN025K16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN033G13+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGAAGC-TTCCACATGGTCCAGTAT
rJMFF020O01- CAACCACC
JMFF016K14+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN031H21+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN011E22+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF022M24- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF028A12- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF028A12+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFF043G15+ CAACCACNTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFF043O24+ CAACCACNTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFF028L01+ CAACCACNTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN028M12+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN042J10+ CAACCACGTGAGTCGCGTCGGTGCTCCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN028H10+ TCCAGTAT
JMFF002H16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFF027F21+ CAACCACNTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF016C06- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF016H24- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF029D04+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN033H22+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN039L12+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN038A18+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN004I21+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN003P17+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN015N23+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN003L11+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN038O04+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN016G01+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN005B03+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN008J16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN009K18+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN004D18+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN025E19+ CAACCACCTGAGT-GCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN004P04+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN034F06+ CAACCACCTGAGTCACGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN016M10+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN019D08+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN018B02+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN038C17+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN040F16+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFF008D15+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN011D02+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN011E08+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN038P11+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN020M01+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN003I19+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF013I05+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN004G04+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFF022M24+ TGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF006L10+ TCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF016J17- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF051P07+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF022L22- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF031M19- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF029D04- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMSF016D23- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFN016P02+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF051L03+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF046O15+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF031M19+ CAACCACNTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF023P10- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
rJMFF022K10- CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF029H18+ CAACCACNTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFF022K10+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF022L22+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF016M12+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF016N22+ CAACCACNTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF016J17+ CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF006H10+ GCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMSF010G13+ TCGGTGCACCCGAACATGGGCAGCTTTCCACATGGTCCAGTAT
JMFS100G06+ -GACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
JMFS097A04+ -GACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
                      ____________________________________________________________
consensus CAACCACCTGAGTCGCGTCGGTGCACCCGAACATGGGCAGC-TTCCACATGGTCCAGTAT
 
. : . : . : . : . : . :
JMFS050F10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN034H06- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN016L16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN035C01+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN004N06+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN042M08- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF043O24- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN004E21+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN005F15+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN009E07+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN035M13- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF037F13- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF031E10- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF028D05- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN003L19+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF023C22- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF016N22- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF013P01- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN007G17+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN025D20+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF006L10- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN004O16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF005C19- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF002H16- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF042N10- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF011P07- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF006H12- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF027F21- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF010G13- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF003N03- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN008B24+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF028L01- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF013I05- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF046O15- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN029L20+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF039O13- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF043G15- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF042N10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF040L23- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF039L23- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF051P07- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF051L03- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF039L23+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF049G13- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF049G13+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF044G04- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF029H18- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF040L23+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF016C06+ CGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF016M12- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN031C21+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN028P07+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN025K18+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN033N15+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN035O07+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN019O10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN015N15+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN039H16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN015J13+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN006I12+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN020F09+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN014J22+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN025H08+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN032G08+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN025I18+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN015K19+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN038H15+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN040H12+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCTCGGTACACGAATCCTTTCTCGGTC
JMFN008P04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN041J04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN019E13+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN014P18+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN033N11+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN042J11+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN040E09+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN030E16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN018C05+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN008O03+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN009G13+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN007B02+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN025C24+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN043G17+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN046A08+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN016F09+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN037P21+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN015F07+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN016A16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN039E16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN015B04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN011O10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN009I01+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN039D12+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN029L04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN036P01+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN011H13+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN008G07+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFS036B10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFS160H07+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN001D01+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN002G11+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN046J18+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN025K16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN033G13+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFF016K14+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN031H21+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN011E22+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF022M24- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF028A12- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF028A12+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFF043G15+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFF043O24+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFF028L01+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN028M12+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCGCGGTACACGAATCCTTTATCGGTC
JMFN042J10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN028H10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTGCACGAATCCTTTCTCGGTC
JMFF002H16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFF027F21+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF016C06- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF016H24- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF029D04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN033H22+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN039L12+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN038A18+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN004I21+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN003P17+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN015N23+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN003L11+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN038O04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN016G01+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN005B03+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN008J16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN009K18+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN004D18+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN025E19+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN004P04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN034F06+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN016M10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN019D08+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN018B02+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN038C17+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN040F16+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFF008D15+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN011D02+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN011E08+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN038P11+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCATTTCTCGGTC
JMFN020M01+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN003I19+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF013I05+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN004G04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFF022M24+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF006L10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF016J17- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF051P07+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF022L22- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF031M19- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF029D04- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMSF016D23- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFN016P02+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF051L03+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF046O15+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF031M19+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF023P10- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
rJMFF022K10- CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF029H18+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFF022K10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF022L22+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF016M12+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF016N22+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF016J17+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF006H10+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF010G13+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMSF013P01+ TCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFS100G06+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
JMFS097A04+ CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
                      ____________________________________________________________
consensus CTTCCGTCATAGTACCCGGGTGAAGCGTGCCATTCACGGTACACGAATCCTTTCTCGGTC
 
. : . : . : . : . : . :
JMFS050F10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN034H06- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN016L16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN035C01+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN004N06+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN042M08- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMFF043O24- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN004E21+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN005F15+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN009E07+ TCGAATTCCAAGCAAGGAAACCATCCCTTGTTCAAAA-GGTACTCCA
JMFN035M13- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF037F13- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF031E10- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF028D05- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN003L19+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMFF023C22- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF016N22- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF013P01- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN007G17+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN025D20+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF006L10- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN004O16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF005C19- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-NGTACTCCACTTGTTTGAGCA
rJMFF002H16- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF042N10- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF011P07- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF006H12- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMFF027F21- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF010G13- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF003N03- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN008B24+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMFF028L01- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF013I05- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTGCTCCACTTGTTTGAGCAA
rJMSF046O15- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN029L20+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF039O13- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMFF043G15- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF042N10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF040L23- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF039L23- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF051P07- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF051L03- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF039L23+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF049G13- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF049G13+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF044G04- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF029H18- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF040L23+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF016C06+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF016M12- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN031C21+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN028P07+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN025K18+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN033N15+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN035O07+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN019O10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN015N15+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN039H16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN015J13+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN006I12+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN020F09+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN014J22+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN025H08+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN032G08+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN025I18+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN015K19+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN038H15+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN040H12+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN008P04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN041J04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN019E13+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN014P18+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN033N11+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN042J11+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN040E09+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN030E16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN018C05+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN008O03+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN009G13+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN007B02+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN025C24+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN043G17+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN046A08+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN016F09+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN037P21+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN015F07+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN016A16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN039E16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCTACTTGTTTGAGCAA
JMFN015B04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN011O10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN009I01+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN039D12+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN029L04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN036P01+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN011H13+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN008G07+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFS036B10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFS160H07+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN001D01+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN002G11+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN046J18+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN025K16+ TCGAATTCCAAGCAAGGAACCCATCCCTTCTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN033G13+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF016K14+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN031H21+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN011E22+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMFF022M24- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF028A12- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF028A12+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF043G15+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF043O24+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF028L01+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN028M12+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCCAAATGGTACTCCACTTGTTTGAGCAA
JMFN042J10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN028H10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF002H16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF027F21+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF016C06- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF016H24- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF029D04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN033H22+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN039L12+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN038A18+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN004I21+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN003P17+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN015N23+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN003L11+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN038O04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN016G01+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN005B03+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN008J16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN009K18+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN004D18+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN025E19+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN004P04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN034F06+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN016M10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN019D08+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN018B02+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN038C17+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN040F16+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF008D15+ TCGAATTCCAAGCTAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN011D02+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN011E08+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN038P11+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN020M01+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN003I19+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTACACTTGTTTGAGCAA
JMFN028J06+ AGCAAGGAACCCATCCCTTGTTCAAAA-GGTGCTCCACTTGTTTGAGCAA
JMSF013I05+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTGCTCCACTTGTTTGAGCAA
JMFN004G04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF022M24+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF006L10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF016J17- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF051P07+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF022L22- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF031M19- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF029D04- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMSF016D23- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFN016P02+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF051L03+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF046O15+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF031M19+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMFF023P10- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
rJMFF022K10- TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF029H18+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFF022K10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF022L22+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF016M12+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF016N22+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF016J17+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF006H10+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF010G13+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF013P01+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF003N03+ CCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMSF005C17+ TGAGCAA
JMFS100G06+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
JMFS097A04+ TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
                      ____________________________________________________________
consensus TCGAATTCCAAGCAAGGAACCCATCCCTTGTTCAAAA-GGTACTCCACTTGTTTGAGCAA
 
. : . : . : . : . : . :
JMFS050F10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGA
JMFN034H06- TTGCTCGGTGCTCAAGGGAGGCAGGTATGA
JMFN016L16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCC
JMFN035C01+ TTGCTCGGT
JMFN004N06+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN042M08- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF043O24- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN004E21+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN005F15+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTC
JMFN035M13- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF037F13- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF031E10- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF028D05- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN003L19+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF023C22- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF016N22- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF013P01- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN007G17+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN025D20+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF006L10- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN004O16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF002H16- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF042N10- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF011P07- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF006H12- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF027F21- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF010G13- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF003N03- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN008B24+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF028L01- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF013I05- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF046O15- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN029L20+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF039O13- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF043G15- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF042N10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF040L23- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF039L23- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF051P07- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF051L03- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF039L23+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF049G13- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCAAACTTTTTCAACCCGAATGG
JMSF049G13+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCAAACTTTTTCAACCCGAATGG
rJMSF044G04- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF029H18- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF040L23+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF016C06+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF016M12- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN031C21+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN028P07+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN025K18+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN033N15+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN035O07+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN019O10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN015N15+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN039H16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN015J13+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN006I12+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN020F09+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN014J22+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN025H08+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN032G08+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN025I18+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN015K19+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN038H15+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN040H12+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCACCCCGAATGG
JMFN008P04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN041J04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN019E13+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN014P18+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN033N11+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN042J11+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN040E09+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN030E16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN018C05+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN008O03+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN009G13+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN007B02+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN025C24+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN043G17+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN046A08+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN016F09+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN037P21+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN015F07+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN016A16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN039E16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN015B04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN011O10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN009I01+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN039D12+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN029L04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGATCTTCTTCAACCCGAATGG
JMFN036P01+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN011H13+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN008G07+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFS036B10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFS160H07+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN001D01+ TTGCTCGGTGCTCAAGGGAGGAAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN002G11+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN046J18+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN025K16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN033G13+ TTGCT-GGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF016K14+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN031H21+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN011E22+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF022M24- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF028A12- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF028A12+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF043G15+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF043O24+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF028L01+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN028M12+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN042J10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN028H10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF002H16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF027F21+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF016C06- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF016H24- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF029D04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN033H22+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN039L12+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN038A18+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN004I21+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN003P17+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN015N23+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN003L11+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN038O04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN016G01+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN005B03+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN008J16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN009K18+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN004D18+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN025E19+ TTGCTCTGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN004P04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN034F06+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN016M10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN019D08+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN018B02+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN038C17+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN040F16+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF008D15+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN011D02+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN011E08+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN038P11+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN020M01+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN003I19+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN028J06+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAGCTTCTTCAACCCGAATGG
JMSF013I05+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN004G04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF022M24+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF006L10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF016H24+ AACCCGAATGG
rJMSF016J17- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF051P07+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF022L22- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF031M19- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF029D04- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMSF016D23- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFN016P02+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF051L03+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF046O15+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF031M19+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF023P10- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
rJMFF022K10- TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF029H18+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFF022K10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF022L22+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF016M12+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF016N22+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF016J17+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF006H10+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF010G13+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF013P01+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF003N03+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF005C17+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMSF016D23+ TCAACCCGAATGG
JMFS100G06+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
JMFS097A04+ TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
                      ____________________________________________________________
consensus TTGCTCGGTGCTCAAGGGAGGCAGGTATGACAGGGTCTCGAACTTCTTCAACCCGAATGG
 
. : . : . : . : . : . :
JMFN004N06+ GGGCCACACCTGCATGCATTG
JMFN042M08- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCG
rJMFF043O24- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN035M13- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF037F13- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF031E10- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF028D05- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN003L19+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMFF023C22- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF016N22- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF013P01- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN007G17+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN025D20+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF006L10- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGA
JMFN004O16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMFF002H16- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF042N10- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF011P07- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF006H12- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMFF027F21- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF010G13- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF003N03- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN008B24+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMFF028L01- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF013I05- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF046O15- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN029L20+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF039O13- GGGCCACACCTGCATGCATTGTACTCGGT-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMFF043G15- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF042N10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF040L23- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF039L23- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF051P07- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF051L03- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF039L23+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF049G13- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF049G13+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF044G04- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF029H18- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF040L23+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF016C06+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF016M12- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN031C21+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN028P07+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN025K18+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN033N15+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN035O07+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN019O10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN015N15+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN039H16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN015J13+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN006I12+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN020F09+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN014J22+ GGGCCACACATGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN025H08+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN032G08+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN025I18+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN015K19+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN038H15+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN040H12+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN008P04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN041J04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN019E13+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN014P18+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN033N11+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN042J11+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN040E09+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN030E16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN018C05+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN008O03+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN009G13+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN007B02+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN025C24+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN043G17+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN046A08+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN016F09+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN037P21+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN015F07+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN016A16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN039E16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN015B04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN011O10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN009I01+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN039D12+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN029L04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN036P01+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN011H13+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN008G07+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFS036B10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFS160H07+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN001D01+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN002G11+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN046J18+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN025K16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN033G13+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFF016K14+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN031H21+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN011E22+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMFF022M24- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF028A12- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF028A12+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFF043G15+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFF043O24+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFF028L01+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN028M12+ GGGCCACACCTGCATGCATTGTACTCGGTCTACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN042J10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN028H10+ GGGCCACACCTGCATGCATTGTACTCGGCTTACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN030D12+ TGGAAGTAAAGTCGG
JMFF002H16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFF027F21+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF016C06- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF016H24- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF029D04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN033H22+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN039L12+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN038A18+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN004I21+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN003P17+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN015N23+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN003L11+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN038O04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN016G01+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN005B03+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN008J16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN009K18+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN004D18+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN025E19+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN004P04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN034F06+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN016M10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN019D08+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN018B02+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN038C17+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN040F16+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFF008D15+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN011D02+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN011E08+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN038P11+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN020M01+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN003I19+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN028J06+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF013I05+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN004G04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFF022M24+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF006L10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF016H24+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF016J17- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF051P07+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF022L22- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF031M19- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF029D04- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMSF016D23- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFN016P02+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF051L03+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF046O15+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF031M19+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMFF023P10- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
rJMFF022K10- GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF029H18+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFF022K10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF022L22+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF016M12+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF016N22+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF016J17+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF006H10+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF010G13+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF013P01+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF003N03+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF005C17+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF016D23+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMSF011P07+ CCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFS100G06+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
JMFS097A04+ GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
                      ____________________________________________________________
consensus GGGCCACACCTGCATGCATTGTACTCGGC-TACCGTTGGTGGAGATGGAAGTAAAGTCGG
 
. : . : . : . : . : . :
rJMFF043O24- CGGCGGAC
JMFN035M13- CGGCGGACTT-C
rJMSF037F13- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF031E10- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF028D05- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN003L19+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMFF023C22- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF016N22- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF013P01- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN007G17+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN025D20+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN004O16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMFF002H16- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF042N10- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF011P07- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF006H12- CGGCGGACTT-CTTGGTGACGGGGAAAGGAGGCGGTGGACTTGANGCCGGTGAAGGGGGC
rJMFF027F21- CGGCGGACTT-CTTGGTGACGGGGAAAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF010G13- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF003N03- CGGAGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN008B24+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMFF028L01- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF013I05- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF046O15- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN029L20+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF039O13- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMFF043G15- CGGCGGACTT-CTTGGTGAC
JMSF042N10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF040L23- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF039L23- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF051P07- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF051L03- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF039L23+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF049G13- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF049G13+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF044G04- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF029H18- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF040L23+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF016C06+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF016M12- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN031C21+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN028P07+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN025K18+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN033N15+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN035O07+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN019O10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN015N15+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN039H16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN015J13+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN006I12+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN020F09+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN014J22+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN025H08+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN032G08+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN025I18+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN015K19+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN038H15+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN040H12+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGATGGACTTGAGGCCGGTGAAGGGGGC
JMFN008P04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN041J04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN019E13+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN014P18+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN033N11+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN042J11+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN040E09+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN030E16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN018C05+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN008O03+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN009G13+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN007B02+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN025C24+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN043G17+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN046A08+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN016F09+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN037P21+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN015F07+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN016A16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN039E16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN015B04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN011O10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN009I01+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN039D12+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN029L04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN036P01+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN011H13+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN008G07+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFS036B10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFS160H07+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN001D01+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN002G11+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN046J18+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN025K16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN033G13+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF016K14+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN031H21+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN011E22+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMFF022M24- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF028A12- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF028A12+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF043G15+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF043O24+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF028L01+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN028M12+ CGCCGGGCTT-CTTGGTGACGGGG-AAGGAGACGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN042J10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN028H10+ CGGCGGACTTGCTTGGTGACGGGG-AAGAAGACGGTGTACTTGAGGCCGGTGAAGGGGGC
JMFN030D12+ CGGCGGGCTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF002H16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF027F21+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF016C06- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF016H24- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF029D04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN033H22+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN039L12+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN038A18+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN004I21+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN003P17+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN015N23+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN003L11+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN038O04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN016G01+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN005B03+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN008J16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN009K18+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN004D18+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN025E19+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN004P04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN034F06+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN016M10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN019D08+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN018B02+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN038C17+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN040F16+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF008D15+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN011D02+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN011E08+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN038P11+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN020M01+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN003I19+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN028J06+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF013I05+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN004G04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF022M24+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF006L10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF016H24+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF016J17- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF051P07+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF022L22- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF031M19- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF029D04- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMSF016D23- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFN016P02+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF051L03+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF046O15+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF031M19+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMFF023P10- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
rJMFF022K10- CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF029H18+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFF022K10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF022L22+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF016M12+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF016N22+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF016J17+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF006H10+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF010G13+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF013P01+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF003N03+ CGGAGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF005C17+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF016D23+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMSF011P07+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFS100G06+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
JMFS097A04+ CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
                      ____________________________________________________________
consensus CGGCGGACTT-CTTGGTGACGGGG-AAGGAGGCGGTGGACTTGAGGCCGGTGAAGGGGGC
 
. : . : . : . : . : . :
rJMSF037F13- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF031E10- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF028D05- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGA
JMFN003L19+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCG
rJMFF023C22- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGG
rJMSF016N22- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGA
rJMSF013P01- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGANGAGA
JMFN007G17+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCG
JMFN025D20+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCG
JMFN004O16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCG
rJMFF002H16- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGANGAGA
rJMSF042N10- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAG
rJMSF011P07- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAG
rJMSF006H12- GACCATGCTGGCTTGG
rJMFF027F21- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGA
rJMSF010G13- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAG
rJMSF003N03- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAG
JMFN008B24+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAG
rJMFF028L01- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAG
rJMSF013I05- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGA
rJMSF046O15- GACCATGCTGGCTTGGGCA
JMFN029L20+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF039O13- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF042N10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF040L23- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF039L23- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF051P07- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF051L03- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF039L23+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF049G13- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF049G13+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF044G04- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGATGAGAGGACTG
rJMSF029H18- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF040L23+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF016C06+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF016M12- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN031C21+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN028P07+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN025K18+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN033N15+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN035O07+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN019O10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN015N15+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN039H16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN015J13+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN006I12+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN020F09+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN014J22+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN025H08+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN032G08+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN025I18+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN015K19+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN038H15+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN040H12+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN008P04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN041J04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN019E13+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN014P18+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN033N11+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN042J11+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN040E09+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN030E16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN018C05+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN008O03+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN009G13+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN007B02+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN025C24+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN043G17+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN046A08+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN016F09+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN037P21+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN015F07+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN016A16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN039E16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN015B04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN011O10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN009I01+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN039D12+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN029L04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN036P01+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN011H13+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN008G07+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFS036B10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFS160H07+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN001D01+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN002G11+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN046J18+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN025K16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN033G13+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFF016K14+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN031H21+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN011E22+ GACCATGCTGGCTTGGGCAGC-GGTGG-GCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMFF022M24- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF028A12- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF028A12+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFF043G15+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFF043O24+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFF028L01+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN028M12+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTT
JMFN042J10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN028H10+ GACCATGCTGGCTTGGGCAGC-GGTGGCTCGGGAGGCGATGGCGGTGGAGGAGAG
JMFN030D12+ GACCATTCTGGCTTGGGCAGC-GGTGTCGCGGGAGGCGATGGCGGTGGAGGAGTTGACTG
JMFF002H16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFF027F21+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF016C06- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF016H24- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGAGATGGCGGTGGAGGAGAGGACTG
JMSF029D04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN033H22+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN039L12+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN038A18+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN004I21+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN003P17+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN015N23+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN003L11+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN038O04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGA
JMFN016G01+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN005B03+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN008J16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN009K18+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN004D18+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN025E19+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN004P04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN034F06+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN016M10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN019D08+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN018B02+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN038C17+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN040F16+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGAT
JMFF008D15+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN011D02+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN011E08+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN038P11+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN020M01+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN003I19+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN028J06+ GACCATGCTGGCTTGGGCATCAGGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF013I05+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN004G04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFF022M24+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF006L10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF016H24+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGAGATGGCGGTGGAGGAGAGGACTG
rJMSF016J17- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF051P07+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF022L22- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMSF031M19- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGA
rJMSF029D04- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAG
rJMSF016D23- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFN016P02+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF051L03+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF046O15+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF031M19+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMFF023P10- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
rJMFF022K10- GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF029H18+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFF022K10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF022L22+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF016M12+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF016N22+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF016J17+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF006H10+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF010G13+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF013P01+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF003N03+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF005C17+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF016D23+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMSF011P07+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFS100G06+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
JMFS097A04+ GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
                      ____________________________________________________________
consensus GACCATGCTGGCTTGGGCAGC-GGTGGCGCGGGAGGCGATGGCGGTGGAGGAGAGGACTG
 
. : . : . : . : . : . :
rJMSF037F13- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTA
rJMSF031E10- ANGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN029L20+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTA
JMSF039O13- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTA
JMSF042N10+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACT
rJMSF040L23- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGC
rJMSF039L23- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGC
rJMSF051P07- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGCC
rJMSF051L03- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF039L23+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGC
rJMSF049G13- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGC
JMSF049G13+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGC
rJMSF044G04- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
rJMSF029H18- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTGTTTACTTTGTAATGGTC
JMSF040L23+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGC
JMSF016C06+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGC
rJMSF016M12- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMFN031C21+ AGGAGGCCATTGCTAGCTGCCTG
JMFN028P07+ AGGAGGCCATTGCTAGCTGCCTG
JMFN025K18+ AGGAGGCCATTGCTAGCTGCCTG
JMFN033N15+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN035O07+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG
JMFN019O10+ AGGAGGCCATTGCTAG
JMFN015N15+ AGGAGGCCATTGC
JMFN039H16+ AGGAGGCCATTGCTAGCT
JMFN015J13+ AGGAGGCCATTGCTAGCTGCC
JMFN006I12+ AGGAGGCCATTGCTAGCTGCC
JMFN020F09+ AGGAGGCCA
JMFN014J22+ AGGAGGCCATTGC-AGCTGCCTGTG
JMFN025H08+ AGGAGGCCATTGC
JMFN032G08+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTT
JMFN025I18+ AGGAGGCCATTGCTAGCTGCCTGTGCTG
JMFN015K19+ AGGAGGCCATTGCTAGCTGCCTGTGCTG
JMFN038H15+ AGGAGGCCATTGCTAGCTGCCTG
JMFN040H12+ AGGAGGCCATTGCTAGCTGCCTGTGCTGC
JMFN008P04+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG
JMFN041J04+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN019E13+ AGGAGGCCATTGCTAGCTGCCTGTGCT
JMFN014P18+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAG
JMFN033N11+ AGGAGGCCATTGCTAGCTGCCTGTG
JMFN042J11+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN040E09+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN030E16+ AGGAGGCCATTGCTAGCTGCCTGTG
JMFN018C05+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN008O03+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTAC
JMFN009G13+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTA
JMFN007B02+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTA
JMFN025C24+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTT
JMFN043G17+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN046A08+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAG
JMFN016F09+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN037P21+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN015F07+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTT
JMFN016A16+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN039E16+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN015B04+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN011O10+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTAC
JMFN009I01+ AGGAGGCCATTGCTAGCTGCCTGTGCTG
JMFN039D12+ AGGAGGCCATTGCTAGCTGCCTGTGCTG
JMFN029L04+ AGGAGGCCATTGCTAGCTGCCTGTG
JMFN036P01+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACT
JMFN011H13+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTG
JMFN008G07+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFS036B10+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCAC
JMFS160H07+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN001D01+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG
JMFN002G11+ AGGAGGCCATTGCTAGCTGCCTGTGC
JMFN046J18+ AGGAGGCCATTGCTAGCTG
JMFN025K16+ AGGAGGCCATTGCTAGCTGCCTGTGCTG
JMFN033G13+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTG
JMFF016K14+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGT
JMFN031H21+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAG
JMFN011E22+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG
rJMFF022M24- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAA
rJMSF028A12- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TT
JMSF028A12+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TT
JMFF043G15+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAAT
JMFF043O24+ AGGAGGCCATTGCTAGCTGCGTGTGCTGCACTGAGTACTTG-TTACTTTGTAAT
JMFF028L01+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAAT
JMFN028M12+ AGGAGGCCATTGCTAGCTGCCTG
JMFN042J10+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN030D12+ AGGAGGCCATTGCTAGCTGCCTG
JMFF002H16+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAAT
JMFF027F21+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAAT
rJMSF016C06- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGC
rJMSF016H24- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATC
JMSF029D04+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATC
JMFN033H22+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTAC
JMFN039L12+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCAC
JMFN038A18+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN004I21+ AGGAGGCCATTGCTAGCTGCCT
JMFN003P17+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCAC
JMFN015N23+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTT
JMFN003L11+ AGGAGGCCATTGCTAGCTGCCTGTGC
JMFN016G01+ AGGAGGCCATTGCTAGCTGCCTGTG
JMFN005B03+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAG
JMFN008J16+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN009K18+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN004D18+ AGGAGGCCATTGCTAGCTG
JMFN025E19+ AGGAGGCCATTGCTAGCTGCCTGTG
JMFN004P04+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN034F06+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGA
JMFN016M10+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN019D08+ AGGAGGCCATTGCTAGCTGCCT
JMFN018B02+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN038C17+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFF008D15+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGT
JMFN011D02+ AGGAGGCCATTGCTAGCTGCCTGTG
JMFN011E08+ AGGAGGCCATTGCTAGCTGCCTGTGCTG
JMFN038P11+ AGGAGGCCATTGCTAGCTGCCTGTGCTG
JMFN020M01+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFN003I19+ AGGAGGCCATTGCTAGCTG
JMFN028J06+ AGGAGGCC
JMSF013I05+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGT
JMFN004G04+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMFF022M24+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAA
JMSF006L10+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TT
JMSF016H24+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATC
rJMSF016J17- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF051P07+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGCC
rJMSF022L22- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
rJMSF016D23- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGCC
JMFN016P02+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCA
JMSF051L03+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF046O15+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF031M19+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
rJMFF023P10- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAAT
rJMFF022K10- AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAAT
JMSF029H18+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMFF022K10+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAAT
JMSF022L22+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF016M12+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF016N22+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGG
JMSF016J17+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF006H10+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF010G13+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF013P01+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGCC
JMSF003N03+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGCC
JMSF005C17+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMSF016D23+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGCC
JMSF011P07+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTC
JMFS100G06+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTGGT
JMFS097A04+ AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTGGT
                      ____________________________________________________________
consensus AGGAGGCCATTGCTAGCTGCCTGTGCTGCACTGAGTACTTG-TTACTTTGTAATGGTCGT
 
. : . : . : . : . : . :
JMFS100G06+ GATAGGGTGGTATTGGTTGGTATATATAACGATAAGGTGTCACATGAGTCCAATCTAACG
JMFS097A04+ GATAGGGTGGTATTGGTTGGTATATATAACGATAAGGTGTCACATGAGTCCAATCTAACG
                      ____________________________________________________________
consensus GATAGGGTGGTATTGGTTGGTATATATAACGATAAGGTGTCACATGAGTCCAATCTAACG
 
. : . : . : . : . : . :
JMFS100G06+ GGCGACGTTGAATCAACCTAATCTTTGAGGAAGCAGGGCCATTGGATTTATGTGGTGCAT
JMFS097A04+ GGCGACGTTGAATCAACCTAATCTTTGAGGAAGCAGGGCCATTGGATTTATGTGGTGCAT
                      ____________________________________________________________
consensus GGCGACGTTGAATCAACCTAATCTTTGAGGAAGCAGGGCCATTGGATTTATGTGGTGCAT