Previous Contig 003643:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033F19Sequence564003643 (3)gb:AP005295_18500396e-90Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ16717009767 (2)gb:AP000421_18201846e-75Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T13C12.
JMFF033H07Sequence515003643 (3)gb:AP005295_18500394e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ16782009767 (2)gb:AP000421_18201842e-86Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T13C12.
JMFS096G06Sequence627003643 (3)gb:AP005295_1850039e-101Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ16

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF033F19+ ACCGCAAAAGA
JMFS096G06+ CCCAGCCCTTGTGATCACCGCAAAAGA
                      ____________________________________________________________
consensus CCCAGCCCTTGTGATCACCGCAAAAGA
 
. : . : . : . : . : . :
JMFF033F19+ TTGTCCTCCAAAGACGAACAGCAACATAGCCAGCTGCAACACCAAGAATCATGTAGATAA
JMFF033H07+ ACACCAAGAATCATGTAGATAA
JMFS096G06+ TTGTCCTCCAAAGACGAACAGCAACATAGCCAGCTGCAACACCAAGAATCATGTAGATAA
                      ____________________________________________________________
consensus TTGTCCTCCAAAGACGAACAGCAACATAGCCAGCTGCAACACCAAGAATCATGTAGATAA
 
. : . : . : . : . : . :
JMFF033F19+ ACAGCATACCCGTAATCAATGTTCCACGCGAAGCTGGGGACATGAATCCAAGAGCAGCAA
JMFF033H07+ ACAGCATACCCGTAATCAATGTTCCACGCGAAGCTGGGGACATGAATCCAAGAGCAGCAA
JMFS096G06+ ACAGCATACCCGTAATCAATGTTCCACGCGAAGCTGGGGACATGAATCCAAGAGCAGCAA
                      ____________________________________________________________
consensus ACAGCATACCCGTAATCAATGTTCCACGCGAAGCTGGGGACATGAATCCAAGAGCAGCAA
 
. : . : . : . : . : . :
JMFF033F19+ ACAGAATAGTCACCACTGCCATTCCTAGGATCTGAACTCCATCTCCAACCATCACACACA
JMFF033H07+ ACAGAATAGTCACCACTGCCATTCCTAGGATCTGAACTCCATCTCCAACCATCACACACA
JMFS096G06+ ACAGAATAGTCACCACTGCCATTCCTAGGATCTGAACTCCATCTCCAACCATCACACACA
                      ____________________________________________________________
consensus ACAGAATAGTCACCACTGCCATTCCTAGGATCTGAACTCCATCTCCAACCATCACACACA
 
. : . : . : . : . : . :
JMFF033F19+ ACAATGCTGGATTACTTGGTGCTCGAAACACATCAGCAACAACAAGTTTCCACCCTGATA
JMFF033H07+ ACAATGCTGGATTACTTGGTGCTCGAAACACATCAGCAACAACAAGTTTCCACCCTGATA
JMFS096G06+ ACAATGCTGGATTACTTGGTGCTCGAAACACATCAGCAACAACAAGTTTCCACCCTGATA
                      ____________________________________________________________
consensus ACAATGCTGGATTACTTGGTGCTCGAAACACATCAGCAACAACAAGTTTCCACCCTGATA
 
. : . : . : . : . : . :
JMFF033F19+ ACTCCTCATTCATCTGGGCTTGGGCCTCTTTGTCAAGCTCCTCATACCTTGTGAGATCTC
JMFF033H07+ ACTCCTCATTCATCTGGGCTTGGGCCTCTTTGTCAAGCTCCTCATACCTTGTGAGATCTC
JMFS096G06+ ACTCCTCATTCATCTGGGCTTGGGCCTCTTTGTCAAGCTCCTCATACCTTGTGAGATCTC
                      ____________________________________________________________
consensus ACTCCTCATTCATCTGGGCTTGGGCCTCTTTGTCAAGCTCCTCATACCTTGTGAGATCTC
 
. : . : . : . : . : . :
JMFF033F19+ GTCTAACAGTCCTCAAGAAGATCACAAGCACAATTCCAGCTAAGAAAGTAATAACCATGA
JMFF033H07+ GTCTAACAGTCCTCAAGAAGATCACAAGCACAATTCCAGCTAAGAAAGTAATAACCATGA
JMFS096G06+ GTCTAACAGTCCTCAAGAAGATCACAAGCACAATTCCAGCTAAGAAAGTAATAACCATGA
                      ____________________________________________________________
consensus GTCTAACAGTCCTCAAGAAGATCACAAGCACAATTCCAGCTAAGAAAGTAATAACCATGA
 
. : . : . : . : . : . :
JMFF033F19+ GAGAGTTGAGAATAGAGAACCAGTGCACCTTTGCCCCCTCCATCTTCAAATATGCATCCC
JMFF033H07+ GAGAGTTGAGAATAGAGAACCAGTGCACCTTTGCCCCCTCCATCTTCAAATATGCATCCC
JMFS096G06+ GAGAGTTGAGAATAGAGAACCAGTGCACCTTTGCCCCCTCCATCTTCAAATATGCATCCC
                      ____________________________________________________________
consensus GAGAGTTGAGAATAGAGAACCAGTGCACCTTTGCCCCCTCCATCTTCAAATATGCATCCC
 
. : . : . : . : . : . :
JMFF033F19+ ACCTCGATGGCAACTTGATATCACTCCCAACAAAGTTGACCTCATACGAAAAGGCCACAG
JMFF033H07+ ACCTCGATGGCAACTTGATATCACTCTCAACAAAGTTGACCTCATACGAAAAGGCCACAG
JMFS096G06+ ACCTCGATGGCCACTTGATATCACTCTCAACAAAGTTGACCTCATACGAAAAGGCCACAG
                      ____________________________________________________________
consensus ACCTCGATGGCAACTTGATATCACTCTCAACAAAGTTGACCTCATACGAAAAGGCCACAG
 
. : . : . : . : . : . :
JMFF033F19+ GTTCACTTTCTTTAATAGCCATACCAACTGTAGTAGGATCACACTTAATTGGAGATGGGT
JMFF033H07+ GTTCACTTTCTTTAATAGCCATTCCAACTGTAGTAGGATCACACTTAATTGGAGATGGGT
JMFS096G06+ GTTCACTTTCTTTAATAGCCATTCCAACTGTAGTAGGATCACACTTAATTGGAGATGGGT
                      ____________________________________________________________
consensus GTTCACTTTCTTTAATAGCCATTCCAACTGTAGTAGGATCACACTTAATTGGAGATGGGT
 
. : . : . : . : . : . :
JMFF033F19+ ATTTACCATACAT
JMFF033H07+ ATTTACCATACAT
JMFS096G06+ ATTTACCATACATCTTCAAGTTCTTCAATGACTCGGCATTGTGCTGGAAACTACAAGGGA
                      ____________________________________________________________
consensus ATTTACCATACATCTTCAAGTTCTTCAATGACTCGGCATTGTGCTGGAAACTACAAGGGA