Previous Contig 003638:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS096C05Sequence618003638 (2)gb:AY162184_15857847e-82Populus tremuloides cellulose synthase-like protein D4 (CSLD4) mRNA, partial cds
JMFS151C10Sequence611003638 (2)gb:AY162184_15857841e-87Populus tremuloides cellulose synthase-like protein D4 (CSLD4) mRNA, partial cds

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS151C10+ TGGGTAATTGGC
                      ____________________________________________________________
consensus TGGGTAATTGGC
 
. : . : . : . : . : . :
JMFS151C10+ AGCAAGAATAGACAGTATGGTATTAGCAGTAACAAGTGGTGGCTCTTTCTCGGGATCGGC
                      ____________________________________________________________
consensus AGCAAGAATAGACAGTATGGTATTAGCAGTAACAAGTGGTGGCTCTTTCTCGGGATCGGC
 
. : . : . : . : . : . :
JMFS151C10+ TGTGGAAACAAATATGTCGATACCGGGAAGATCAGATTTCCCCGAGGGATTGGCGGGTGT
                      ____________________________________________________________
consensus TGTGGAAACAAATATGTCGATACCGGGAAGATCAGATTTCCCCGAGGGATTGGCGGGTGT
 
. : . : . : . : . : . :
JMFS151C10+ AGGCGTTTCGAATTTTTCCTTTAGAACATTAAGGTCAGTTGCTCGATTAATCGGGCACAA
JMFS096C05+ TCGATTAATCGGGCACAA
                      ____________________________________________________________
consensus AGGCGTTTCGAATTTTTCCTTTAGAACATTAAGGTCAGTTGCTCGATTAATCGGGCACAA
 
. : . : . : . : . : . :
JMFS151C10+ CTTGGGAAGTTGATCTAGCAGCCAGGAGAACGCAAACCAAATCTCGCATATAATGGACAT
JMFS096C05+ CTTGGGAAGTTGATCTAGCAGCCAGGAGAACGCAAACCAAATCTCGCATATAATGGACAT
                      ____________________________________________________________
consensus CTTGGGAAGTTGATCTAGCAGCCAGGAGAACGCAAACCAAATCTCGCATATAATGGACAT
 
. : . : . : . : . : . :
JMFS151C10+ ATACCATAACCATATCGCATCGTCATTGGGGTGGGTGATTCTCCATTCAAGAAATAGGGC
JMFS096C05+ ATACCATAACCATATCGCATCGTCATTGGGGTGGGTGATTCTCCATTCAAGAAATAGGGC
                      ____________________________________________________________
consensus ATACCATAACCATATCGCATCGTCATTGGGGTGGGTGATTCTCCATTCAAGAAATAGGGC
 
. : . : . : . : . : . :
JMFS151C10+ GAGTACAACAACACGAATCAAAATCAAGAGCCGATATGGACTGAGGACTGCAGCAGGTAT
JMFS096C05+ GAGTACAACAACACGAATCAAAATCAAGAGCCGATATGGACTGAGGACTGCAGCAGGTAT
                      ____________________________________________________________
consensus GAGTACAACAACACGAATCAAAATCAAGAGCCGATATGGACTGAGGACTGCAGCAGGTAT
 
. : . : . : . : . : . :
JMFS151C10+ CTTCAATTTGCGGGTAAGTGGTCTCCATGGCTTGTTAAGAAGTTCGGAAGGCTCACCGTC
JMFS096C05+ CTTCAATTTGCGGGTAAGTGGTCTCCATGGCTTGTTAAGAAGTTCGGAAGGCTCACCGTC
                      ____________________________________________________________
consensus CTTCAATTTGCGGGTAAGTGGTCTCCATGGCTTGTTAAGAAGTTCGGAAGGCTCACCGTC
 
. : . : . : . : . : . :
JMFS151C10+ ATCCTTGTCGTTCCCTAATCCCCCTTCCTTTGGCCATATAGCGTTACCGTAACCATAAGT
JMFS096C05+ ATCCTTGTCGTTCCCTAATCCCCCTTCCTTTGGCCATATAGCGTTACCGTAACCATAAGT
                      ____________________________________________________________
consensus ATCCTTGTCGTTCCCTAATCCCCCTTCCTTTGGCCATATAGCGTTACCGTAACCATAAGT
 
. : . : . : . : . : . :
JMFS151C10+ CCCTTTTGTCTCGAATAACCATCTATTATGGTCGAAATCCCCGGTTTGACTCCTCGTCAA
JMFS096C05+ CCCTTTTGTCTCGAATAACCATCTATTATGGTCGAAATCCCCGGTTTGACTCCTCGTCAA
                      ____________________________________________________________
consensus CCCTTTTGTCTCGAATAACCATCTATTATGGTCGAAATCCCCGGTTTGACTCCTCGTCAA
 
. : . : . : . : . : . :
JMFS151C10+ GCCAGACTGACTTCTTACTATAGCCGATTTGCTGCCTGATTTCATCAATGACAACCTTC
JMFS096C05+ GCCAGACTGACTTCTTACTATAGCCGATTTGCTGCCTGATTTCATCAATGACAACCTTCT
                      ____________________________________________________________
consensus GCCAGACTGACTTCTTACTATAGCCGATTTGCTGCCTGATTTCATCAATGACAACCTTCT
 
. : . : . : . : . : . :
JMFS096C05+ CTCCATCTTAGACATCCCAACGTTCGACGGTAAAGATAAAGGCTGTCTACTATTAGGATC
                      ____________________________________________________________
consensus CTCCATCTTAGACATCCCAACGTTCGACGGTAAAGATAAAGGCTGTCTACTATTAGGATC
 
. : . : . : . : . : . :
JMFS096C05+ TACAGCATTCTGGTCCAACTCGGTGTTCTTGTAAGGCTCTTTACAACCGGGGCAAATCCC
                      ____________________________________________________________
consensus TACAGCATTCTGGTCCAACTCGGTGTTCTTGTAAGGCTCTTTACAACCGGGGCAAATCCC
 
. : . : . : . : . : . :
JMFS096C05+ ATCGCCTGTCTTGACAGCATCTATATAGCAATCCCGGCAAATCTTGAAATCGCATTCACA
                      ____________________________________________________________
consensus ATCGCCTGTCTTGACAGCATCTATATAGCAATCCCGGCAAATCTTGAAATCGCATTCACA