Previous Contig 003635:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS096A07Sequence642003635 (2)sp|Q9C8Z4|BP28_ARATH9e-27Hypothetical protein At3g06530.>gb:AC020580_1538538 Arabidopsis thaliana chromos
JMSF043K12Sequence778003635 (2)sp|Q9C8Z4|BP28_ARATH1e-07Hypothetical protein At3g06530.>gb:AC020580_1538538 Arabidopsis thaliana chromos702024045sp|Q9C8Z4|BP28_ARATH4e-50Hypothetical protein At3g06530.>gb:AC020580_1538538 Arabidopsis thaliana chromos

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF043K12+ ACTCAATTGTGGTAATTGCTGCGAGTTTCAATTG
                      ____________________________________________________________
consensus ACTCAATTGTGGTAATTGCTGCGAGTTTCAATTG
 
. : . : . : . : . : . :
JMSF043K12+ AGTGCTTGAGTCACTTGCAGGATCATCAATAAACTTCAGTATTACTAAACACATCGTGTT
                      ____________________________________________________________
consensus AGTGCTTGAGTCACTTGCAGGATCATCAATAAACTTCAGTATTACTAAACACATCGTGTT
 
. : . : . : . : . : . :
JMSF043K12+ AAAGACTTCCAAAGAATCCTCATCAAGGTGAATCCATGAATTTCTTGAGGTTGAAGTTAG
                      ____________________________________________________________
consensus AAAGACTTCCAAAGAATCCTCATCAAGGTGAATCCATGAATTTCTTGAGGTTGAAGTTAG
 
. : . : . : . : . : . :
JMSF043K12+ TTCTTTTTTCCCACGCTTTGCATCTATGACACCAGTGGCCTTCACGGTGTCACACAAAAT
                      ____________________________________________________________
consensus TTCTTTTTTCCCACGCTTTGCATCTATGACACCAGTGGCCTTCACGGTGTCACACAAAAT
 
. : . : . : . : . : . :
JMSF043K12+ CCCAAGAGCCTTCTTTTTGACATTAATATCTGCATGTCCAAGTAATTGTATAACAATTTT
                      ____________________________________________________________
consensus CCCAAGAGCCTTCTTTTTGACATTAATATCTGCATGTCCAAGTAATTGTATAACAATTTT
 
. : . : . : . : . : . :
JMSF043K12+ GAAGTATATTGATGGTCTGAGGCACTTTGCAATTGCCTTTAAGACAGAGCGTATGCGCTC
                      ____________________________________________________________
consensus GAAGTATATTGATGGTCTGAGGCACTTTGCAATTGCCTTTAAGACAGAGCGTATGCGCTC
 
. : . : . : . : . : . :
JMSF043K12+ CTTCAGTTCCTTCCTGATTAGAGGAGCACTCATCTGCTTTCCATTGGATTCCACCAGTTG
                      ____________________________________________________________
consensus CTTCAGTTCCTTCCTGATTAGAGGAGCACTCATCTGCTTTCCATTGGATTCCACCAGTTG
 
. : . : . : . : . : . :
JMSF043K12+ CAGATGAGAGACCATTTTTTCCAAAATTACACCAATTGATGGCTGAATGCTTTCTGAGCC
                      ____________________________________________________________
consensus CAGATGAGAGACCATTTTTTCCAAAATTACACCAATTGATGGCTGAATGCTTTCTGAGCC
 
. : . : . : . : . : . :
JMSF043K12+ ATCTCCAGAATCAAGCATAAAGGCAATTTCAGGATCTTGCAGCTTATTTGAAACAAAATG
                      ____________________________________________________________
consensus ATCTCCAGAATCAAGCATAAAGGCAATTTCAGGATCTTGCAGCTTATTTGAAACAAAATG
 
. : . : . : . : . : . :
JMSF043K12+ CTCTGCAACTACCAAGACCATAAACAATTCTTCACTTTCACAATCTATTCCTATTTTCTG
                      ____________________________________________________________
consensus CTCTGCAACTACCAAGACCATAAACAATTCTTCACTTTCACAATCTATTCCTATTTTCTG
 
. : . : . : . : . : . :
JMSF043K12+ AAGCAGAATGGCAATGGAGGGAAGCCATACTGTGCATGGATATTGCTCAGACAACAACAC
JMFS096A07+ GGGAAGCCATACTGTGCATGGATATTGCTCAGACAACAACAC
                      ____________________________________________________________
consensus AAGCAGAATGGCAATGGAGGGAAGCCATACTGTGCATGGATATTGCTCAGACAACAACAC
 
. : . : . : . : . : . :
JMSF043K12+ AGCAAATGCATACTCCCATTCCATACTAATTGTAGAGGTTATATAACCCAAAGAAGGACT
JMFS096A07+ AGCAAATGCATACTCCCATTCCATACTAATTGTAGAGGTTATATAACCCAAAGAAGGACT
                      ____________________________________________________________
consensus AGCAAATGCATACTCCCATTCCATACTAATTGTAGAGGTTATATAACCCAAAGAAGGACT
 
. : . : . : . : . : . :
JMSF043K12+ GGCACCACTAGTGCAAGACGAACTCTTTCTTGAGATGACGGAACGGAAGAGGAGGAAGAA
JMFS096A07+ GGCACCACTAGTGCAAGACGAACTCTTTCTTGAGATGACGGAACGGAAGAGGAGGAAGAA
                      ____________________________________________________________
consensus GGCACCACTAGTGCAAGACGAACTCTTTCTTGAGATGACGGAACGGAAGAGGAGGAAGAA
 
. : . : . : . : . : . :
JMSF043K12+ AAGTGATCCCAAACTAGTATTCTC
JMFS096A07+ AAGTGATCCCAAACTAGTATTCTCGCCTAAGTTCTTCAAAAGGTGCGTAATAATTGAAAG
                      ____________________________________________________________
consensus AAGTGATCCCAAACTAGTATTCTCGCCTAAGTTCTTCAAAAGGTGCGTAATAATTGAAAG
 
. : . : . : . : . : . :
JMFS096A07+ CCTCCGATGTTCAGACACTTTGGGCAGAAAATTCACAAATATCTGTAGCAATGCATCCAT
                      ____________________________________________________________
consensus CCTCCGATGTTCAGACACTTTGGGCAGAAAATTCACAAATATCTGTAGCAATGCATCCAT
 
. : . : . : . : . : . :
JMFS096A07+ ACTGTCAGTTTTAGACAACCAACATGGCACAATAGCAGAAATGAGGTCTTCAAAGACGCG
                      ____________________________________________________________
consensus ACTGTCAGTTTTAGACAACCAACATGGCACAATAGCAGAAATGAGGTCTTCAAAGACGCG
 
. : . : . : . : . : . :
JMFS096A07+ TTGAGAATAGCTGTCCCACTGTGTAACTGCAGTTTCCCCCACGATAATCAGAATATCTAA
                      ____________________________________________________________
consensus TTGAGAATAGCTGTCCCACTGTGTAACTGCAGTTTCCCCCACGATAATCAGAATATCTAA
 
. : . : . : . : . : . :
JMFS096A07+ AATGTTGTCCAAAACTCTGTCGGGCATGACCTTTGCAATAGTAGATAACAATGACAAAAC
                      ____________________________________________________________
consensus AATGTTGTCCAAAACTCTGTCGGGCATGACCTTTGCAATAGTAGATAACAATGACAAAAC
 
. : . : . : . : . : . :
JMFS096A07+ ATGATTGCGGGTCAAAGCATCACTTGCAAGACGGGCACATTTGATTAGCAATTCCAAATC
                      ____________________________________________________________
consensus ATGATTGCGGGTCAAAGCATCACTTGCAAGACGGGCACATTTGATTAGCAATTCCAAATC
 
. : . : . : . : . : . :
JMFS096A07+ AAATTCTACACCATCGCCATCCTTGGATGTGATTGAAGTAGCAATATCTTCTAACAGTAG
                      ____________________________________________________________
consensus AAATTCTACACCATCGCCATCCTTGGATGTGATTGAAGTAGCAATATCTTCTAACAGTAG
 
. : . : . : . : . : . :
JMFS096A07+ GAGTGCTGTTTGTTGAATGTGAATTACAGCACTAGAAGTAGTCTGAGAACAAGATGTTAG
                      ____________________________________________________________
consensus GAGTGCTGTTTGTTGAATGTGAATTACAGCACTAGAAGTAGTCTGAGAACAAGATGTTAG