Previous Contig 003630:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS095F08Sequence610003630 (2)pir|T52128|T521282e-04ABC1 protein homolog [imported] - Arabidopsis thaliana>gb:ATJ001158_1553496 Arab
JMSF040A22Sequence665003630 (2)pir|T52128|T521285e-09ABC1 protein homolog [imported] - Arabidopsis thaliana>gb:ATJ001158_1553496 Arab874013266 (2)pir|T02007|T020076e-78ABC1 protein homolog T15B16.14 - Arabidopsis thaliana>gb:ATCHRIV4_1545266 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF040A22+ C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
JMSF040A22+ CATGCAAGTCCAGCCCCAAGGCCTGCAAACCCAAGCGCCCTAGAAAAAGGAGTAGAAGGC
                      ____________________________________________________________
consensus CATGCAAGTCCAGCCCCAAGGCCTGCAAACCCAAGCGCCCTAGAAAAAGGAGTAGAAGGC
 
. : . : . : . : . : . :
JMSF040A22+ ACCNTCCTCTCCCTAGGTTTCCTTTGTTGCCTCTTGATCACTCCTTCTTGAGACGCAGCT
                      ____________________________________________________________
consensus ACCNTCCTCTCCCTAGGTTTCCTTTGTTGCCTCTTGATCACTCCTTCTTGAGACGCAGCT
 
. : . : . : . : . : . :
JMSF040A22+ CCACCAGCGGCGATATTCCGTTGAGTAGAGGCTTCATCCTTCTGAGACGACAAACAAGGA
JMFS095F08+ CAAACAAGGA
                      ____________________________________________________________
consensus CCACCAGCGGCGATATTCCGTTGAGTAGAGGCTTCATCCTTCTGAGACGACAAACAAGGA
 
. : . : . : . : . : . :
JMSF040A22+ TCAGCGTCGGTGGATGTGGCAGCCACTTCTAGAGGCGGAGACACAGAAACCTCCGAATCC
JMFS095F08+ TCAGCGTCGGTGGATGTGGCAGCCACTTCTAGAGGCGGAGACACAGAAACCTCCGAATCC
                      ____________________________________________________________
consensus TCAGCGTCGGTGGATGTGGCAGCCACTTCTAGAGGCGGAGACACAGAAACCTCCGAATCC
 
. : . : . : . : . : . :
JMSF040A22+ TGGGCAATGACATCATTAGAATCAGGAGAACACCGGCTTTGATCTGGTTGAGGGGAAGAA
JMFS095F08+ TGGGCAATGACATCATTAGAATCAGGAGAACACCGGCTTTGATCTGGTTGAGGGGAAGAA
                      ____________________________________________________________
consensus TGGGCAATGACATCATTAGAATCAGGAGAACACCGGCTTTGATCTGGTTGAGGGGAAGAA
 
. : . : . : . : . : . :
JMSF040A22+ TCCACGAAGTGCACGACGCTTTGTTTAACAGCATTAGAATTAGGTTTGGAATTAGGATCA
JMFS095F08+ TCCACGAAGTGCACGACGCTTTGTTTAACAGCATTAGAATTAGGTTTGGAATTAGGATCA
                      ____________________________________________________________
consensus TCCACGAAGTGCACGACGCTTTGTTTAACAGCATTAGAATTAGGTTTGGAATTAGGATCA
 
. : . : . : . : . : . :
JMSF040A22+ ACATCTTCGAAACGCCGAAACCTGCCTTTGGTGAGGCCGGTTAGATCGGTGGCGGATAGA
JMFS095F08+ ACATCTTCGAAACGCCGAAACCTGCCTTTGGTGAGGCCGGTTAGATCGGTGGCGGATAGA
                      ____________________________________________________________
consensus ACATCTTCGAAACGCCGAAACCTGCCTTTGGTGAGGCCGGTTAGATCGGTGGCGGATAGA
 
. : . : . : . : . : . :
JMSF040A22+ AGGGCGGTCTTGATTAGGGATTGCAAATCCGTACCGTCACTGAGCGGTTGCCGGCGGGCA
JMFS095F08+ AGGGCGGTCTTGATTAGGGATTGCAAATCCGTACCGTCACTGAGCGGTTGCCGGCGGGCA
                      ____________________________________________________________
consensus AGGGCGGTCTTGATTAGGGATTGCAAATCCGTACCGTCACTGAGCGGTTGCCGGCGGGCA
 
. : . : . : . : . : . :
JMSF040A22+ GCCTCTTTGGCCACCAAAGACAACCCATTTACCACCCTAGCTATGTCATTCACCTTCATA
JMFS095F08+ GCCTCTTTGGCCACCAAAGACAACCCATTTACCACCCTAGCTATGTCATTCACCTTCATA
                      ____________________________________________________________
consensus GCCTCTTTGGCCACCAAAGACAACCCATTTACCACCCTAGCTATGTCATTCACCTTCATA
 
. : . : . : . : . : . :
JMSF040A22+ TTTCACCAACAACAACAACTCCTGCTAGGGCTGAGTAAGAGAATGGAAGCATGCAATCAC
JMFS095F08+ TTTCACCAACAACAACAACTCCTGCTAGGGCTGAGTAAGAGAATGGAAGCATGCAATCAC
                      ____________________________________________________________
consensus TTTCACCAACAACAACAACTCCTGCTAGGGCTGAGTAAGAGAATGGAAGCATGCAATCAC
 
. : . : . : . : . : . :
JMSF040A22+ AAATGAAAGAAAAAACAGAAGATCAATGCTACGCTAACCAAAATCATTCAATTCACAGCT
JMFS095F08+ AAATGAAAGAAAAAACAGAAGATCAATGCTACGCTAACCAAAATCATTCAATTCACAGCT
                      ____________________________________________________________
consensus AAATGAAAGAAAAAACAGAAGATCAATGCTACGCTAACCAAAATCATTCAATTCACAGCT
 
. : . : . : . : . : . :
JMSF040A22+ TCC
JMFS095F08+ TCCAATTCAATTCAATTCAATTCAATAATATGAAGCTTGGATTGGGGATGCCAGTAATTA
                      ____________________________________________________________
consensus TCCAATTCAATTCAATTCAATTCAATAATATGAAGCTTGGATTGGGGATGCCAGTAATTA
 
. : . : . : . : . : . :
JMFS095F08+ TTGGGAGAGGATCTCTCGGAGCCCTATTCCTGCAGCCGTCGCTAGACGACGTGGCTGTGA
                      ____________________________________________________________
consensus TTGGGAGAGGATCTCTCGGAGCCCTATTCCTGCAGCCGTCGCTAGACGACGTGGCTGTGA