Previous Contig 003628:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006C03Sequence541003628 (15)gb:AF184164_17750193e-57Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.815009021 (16)pir|T07790|T077902e-91transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMFF007L02Sequence600003628 (15)pir|T07790|T077901e-71transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa781009021 (16)pir|T07790|T077904e-84transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMFF007L05Sequence553003628 (15)gb:AF184164_17750191e-58Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.814009021 (16)pir|T07790|T077902e-91transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMFF014M18Sequence549003628 (15)gb:AF184164_17750195e-58Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.791009021 (16)pir|T48589|T485894e-72transaldolase-like protein - Arabidopsis thaliana>gb:ATT22N19_1555309 Arabidopsi
JMFF017K24Sequence611003628 (15)gb:AP004332_18403361e-52Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJN773009021 (16)pir|T07790|T077902e-72transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMFF021E10Sequence251003628 (15)gb:AF184164_17750198e-04Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.684009021 (16)pir|T07790|T077902e-67transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMFF039B09Sequence520003628 (15)gb:AF184164_17750194e-57Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.831009021 (16)pir|T07790|T07790e-105transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMFF041L09Sequence605003628 (15)gb:AF184164_17750191e-71Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.631009021 (16)pir|T07790|T077905e-65transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMFF042D05Sequence644003628 (15)pir|T07790|T077903e-77transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa570009021 (16)pir|T07790|T077902e-57transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMFS095D01Sequence627003628 (15)gb:AF184164_17750192e-55Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.
JMSF003L17Sequence374003628 (15)gb:AF184164_17750192e-24Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.696009021 (16)pir|T07790|T077902e-74transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMSF012G24Sequence225003628 (15)706009021 (16)pir|T07790|T077902e-83transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMSF026J19Sequence638003628 (15)pir|T07790|T077909e-75transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa729009021 (16)pir|T07790|T077904e-84transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMSF028K13Sequence695003628 (15)pir|T07790|T077905e-84transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa697009021 (16)pir|T07790|T077902e-83transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa
JMSF028K14Sequence641003628 (15)gb:AF184164_17750195e-68Lycopersicon esculentum transaldolase (TAL) mRNA, complete cds.699009021 (16)pir|T07790|T077904e-84transaldolase (EC 2.2.1.2) - potato>gb:STU95923_1723163 Solanum tuberosum transa

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF042D05+ ATTACGTCGGTCA
JMSF028K13+ GGATGCATGGGGCTGTAGCAGGNATTTTTATGTACACATTACGTCGGTCA
                      ____________________________________________________________
consensus GGATGCATGGGGCTGTAGCAGGNATTTTTATGTACACATTACGTCGGTCA
 
. : . : . : . : . : . :
JMFF007L02+ CACTTTGCAGCCTCAATAGTTCCTTCAGTATCATCAGCAAGTCTA
JMFF041L09+ AGCCACTTTGCAGCCTCAATAGTTCCTTCAGTATCATCAGCAAGTCTA
JMFF042D05+ ACCTTCTTATGAAGCCACTTTGCAGCCTCAATAGTTCCTTCAGTATCATCAGCAAGTCTA
JMFF017K24+ CAGCCTCAATAGTTCCTTCAGTATCATCAGCAAGTCTA
JMSF026J19+ AGCCACTTTGCAGCCTCAATAGTTCCTTCAGTATCATCAGCAAGTCTA
JMSF028K13+ ACCTTCTTATGAAGCCACTTTGCAGCCTCAATAGTTCCTTCAGTATCATCAGCAAGTCTA
JMSF028K14+ CCTCAATAGTTCCTTCAGTATCATCAGCAAGTCTA
                      ____________________________________________________________
consensus ACCTTCTTATGAAGCCACTTTGCAGCCTCAATAGTTCCTTCAGTATCATCAGCAAGTCTA
 
. : . : . : . : . : . :
JMFF039B09+ TTCTGTTTCGTCATAAATTGGCTCA
JMFF007L02+ GGTGACACTTCAACAGAAACATAGCCATCCCCTGCTTCTGTTTCGTCATAAATTGGCTCA
JMFF041L09+ GGTGACACTTCAACAGAAACATAGCCATCCCCTGCTTCTGTTTCGTCATAAATTGGCTCA
JMFF042D05+ GGTGACACTTCAACAGAAACATAGCCATCCCCTGCTTCTGTTTCGTCATAAATTGGCTCA
JMFF017K24+ GGTGACACTTCAACAGAAACATAGCCATCCCCTGCTTCTGTTTCGTCATAAATTGGCTCA
JMFF014M18+ GCTTCTGTTTCGTCATAAATTGGCTCA
JMFF007L05+ CCCTGCTTCTGTTTCGTCATAAATTGGCTCA
JMSF026J19+ GGTGACACTTCAACAGAAACATAGCCATCCCCTGCTTCTGTTTCGTCATAAATTGGCTCA
JMFF006C03+ TTCGTCATAAATTGGCTCA
JMSF028K13+ GGTGACACTTCAACAGAAACATAGCCATCCCCTGCTTCTGTTTCGTCATAAATTGGCTCA
JMSF028K14+ GGTGACACTTCAACAGAAACATAGCCATCCCCTGCTTCTGTTTCGTCATAAATTGGCTCA
JMFS095D01+ TGCTTCTGTTTCGTCATAAATTGGCTCA
                      ____________________________________________________________
consensus GGTGACACTTCAACAGAAACATAGCCATCCCCTGCTTCTGTTTCGTCATAAATTGGCTCA
 
. : . : . : . : . : . :
JMFF039B09+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMFF007L02+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMFF041L09+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMFF042D05+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMFF017K24+ AAGANTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMFF014M18+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMFF007L05+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMSF026J19+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMFF006C03+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMSF028K13+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMSF028K14+ AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
JMFS095D01+ NAGAGTTGNCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
                      ____________________________________________________________
consensus AAGAGTTTGCATGCATCTTGGATGTCCTTTACCACAAGTTCCCAATACAAACTTTCAATG
 
. : . : . : . : . : . :
JMFF039B09+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMFF007L02+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMFF041L09+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMFF042D05+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMFF017K24+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCANTTTGAAGTAGATAT
JMFF014M18+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMFF007L05+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMSF026J19+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMFF006C03+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMSF028K13+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMSF028K14+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
JMFS095D01+ TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
                      ____________________________________________________________
consensus TCTTTCCCAGCTTGTACAAGTTCCTTGAATTGATCATTATAGGCA-TTTGAAGTAGATAT
 
. : . : . : . : . : . :
JMFF039B09+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTATAACACCGCTCTCAATCAATGG
JMFF007L02+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMFF041L09+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMFF042D05+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMFF017K24+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMFF014M18+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMFF007L05+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMSF026J19+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMFF006C03+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMSF028K13+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMSF003L17+ CTAACACCGCTCTCAATCAATGG
JMSF028K14+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
JMFS095D01+ AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
                      ____________________________________________________________
consensus AGCTTTCTGGAAAATCGCAGGATTGCTGGTAACCCCTCTAACACCGCTCTCAATCAATGG
 
. : . : . : . : . : . :
JMFF039B09+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMFF007L02+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMFF041L09+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMFF042D05+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMFF017K24+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMFF014M18+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMFF007L05+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMSF026J19+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMFF006C03+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMSF028K13+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMSF003L17+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMSF028K14+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
JMFS095D01+ AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
                      ____________________________________________________________
consensus AATTAGATCTGTAACAGGGCGACACAGGTTATCATACCATGGGCTTTGCCCTTGCTTCTC
 
. : . : . : . : . : . :
JMFF039B09+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMFF007L02+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMFF041L09+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMFF042D05+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMFF017K24+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMFF014M18+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMFF007L05+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMSF026J19+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMFF021E10+ GGCTTCCATTTCCTCCACCTTGGGAGCA
JMSF012G24+ ACCTTGGGAGCA
JMFF006C03+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMSF028K13+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMSF003L17+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMSF028K14+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
JMFS095D01+ GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
                      ____________________________________________________________
consensus GTACAGATCATGAAGACTTGTTCTCTTGATTGGGCTTCCATTTCCTCCACCTTGGGAGCA
 
. : . : . : . : . : . :
JMFF039B09+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFF007L02+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFF041L09+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFF042D05+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFF017K24+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFF014M18+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFF007L05+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMSF026J19+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFF021E10+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMSF012G24+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFF006C03+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMSF028K13+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMSF003L17+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMSF028K14+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
JMFS095D01+ TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
                      ____________________________________________________________
consensus TCTAATAACGAGGGAGCCGTTGAGAGAAGGCTTGGCGAAGGCCAACAGCTTAGAAGAGGA
 
. : . : . : . : . : . :
JMFF039B09+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMFF007L02+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMFF041L09+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMFF042D05+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMFF017K24+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMFF014M18+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMFF007L05+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMSF026J19+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMFF021E10+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMSF012G24+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMFF006C03+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMSF028K13+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMSF003L17+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
JMSF028K14+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGG--ATCGACGAAACATTTGGGAGCAGGCGA
JMFS095D01+ AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
                      ____________________________________________________________
consensus AAGCCGGGCGTCGAAGGAGGATTTGTTGCGGATATCGACGAAACATTTGGGAGCAGGCGA
 
. : . : . : . : . : . :
JMFF039B09+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMFF007L02+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMFF041L09+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGACTGGA
JMFF042D05+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMFF017K24+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMFF014M18+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMFF007L05+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMSF026J19+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMFF021E10+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMSF012G24+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMFF006C03+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMSF028K13+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMSF003L17+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMSF028K14+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
JMFS095D01+ TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
                      ____________________________________________________________
consensus TGATCTCCTGGAAGTGAAAGAGGATGAAGAGGCAAAGCCTGGATTGGAGAGCTTGGAAAT
 
. : . : . : . : . : . :
JMFF039B09+ AGTAGCCATGTCCGAC
JMFF007L02+ AGTAGCCATGTCCGAC
JMFF042D05+ AGTAGCCATGTCCGACGGGAGTCTGATG
JMFF017K24+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTG
JMFF014M18+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCC
JMFF007L05+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCC
JMSF026J19+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCC
JMFF021E10+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCC
JMSF012G24+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCT
JMFF006C03+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCC
JMSF028K13+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCC
JMSF003L17+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCC
JMSF028K14+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCCGAGTTTAGCTGCGCTTC
JMFS095D01+ AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCCGAGTTTAGCTGCGCTTC
                      ____________________________________________________________
consensus AGTAGCCATGTCCGACGGGAGTCTGATGCTCTGATTCTCGCCCGAGTTTAGCTGCGCTTC
 
. : . : . : . : . : . :
JMSF028K14+ TTCAAC
JMFS095D01+ TTCAACTACTAGTCTACAAATACTAGGGTTAATAAAAATTTTAAGCAAAAAATTAATGGC
                      ____________________________________________________________
consensus TTCAACTACTAGTCTACAAATACTAGGGTTAATAAAAATTTTAAGCAAAAAATTAATGGC