Previous Contig 003620:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS025B11Sequence631003620 (2)gb:AC104709_17377884e-11Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete s
JMFS094D06Sequence599003620 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS025B11+ GGTCCATACACTACATGATCC
                      ____________________________________________________________
consensus GGTCCATACACTACATGATCC
 
. : . : . : . : . : . :
JMFS025B11+ CCCACCGACATTGAACGTATTTTTTGAAGCTTTTTGGAGTTAACTTCTCGGATTTTATGT
                      ____________________________________________________________
consensus CCCACCGACATTGAACGTATTTTTTGAAGCTTTTTGGAGTTAACTTCTCGGATTTTATGT
 
. : . : . : . : . : . :
JMFS025B11+ CCACAAACGTTTTCCAAGTCAACAACTAGATCAACATTGACAACTCTTCCCGTCTGACCA
                      ____________________________________________________________
consensus CCACAAACGTTTTCCAAGTCAACAACTAGATCAACATTGACAACTCTTCCCGTCTGACCA
 
. : . : . : . : . : . :
JMFS025B11+ GATGGATCCTTTACTAAACAAACTATGTCCCCTTGGGAAAACAGCCTTTCGAAAGAGAGG
JMFS094D06+ ATGGATCCTTTACTAAACAAACTATGTCCCCTTGGGAAAACAGCCTTTCGAAAGAGAGG
                      ____________________________________________________________
consensus GATGGATCCTTTACTAAACAAACTATGTCCCCTTGGGAAAACAGCCTTTCGAAAGAGAGG
 
. : . : . : . : . : . :
JMFS025B11+ AAATCATCGATTTTCTCGATGCTTTCCTCGAGGCTAGATAGAATGGAATAAGCATTTCCA
JMFS094D06+ AAATCATCGATTTTCTCGATGCTTTCCTCGAGGCTAGATAGAATGGAATAAGCATTTCCA
                      ____________________________________________________________
consensus AAATCATCGATTTTCTCGATGCTTTCCTCGAGGCTAGATAGAATGGAATAAGCATTTCCA
 
. : . : . : . : . : . :
JMFS025B11+ CCAAATAGGTGTTCAGCATAATCCTGATCCTCAGAGTTGCTGCTCTCACTGAAACTATCA
JMFS094D06+ CCAAATAGGTGTTCAGCATAATCCTGATCCTCAGAGTTGCTGCTCTCACTGAAACTATCA
                      ____________________________________________________________
consensus CCAAATAGGTGTTCAGCATAATCCTGATCCTCAGAGTTGCTGCTCTCACTGAAACTATCA
 
. : . : . : . : . : . :
JMFS025B11+ ATGTCACTCAAGTTCAAATCCATAATGTGAAAAAGCCACAAGTGTAACTTCAAGGTCCTT
JMFS094D06+ ATGTCACTCAAGTTCAAATCCATAATGTGAAAAAGCCACAAGTGTAACTTCAAGGTCCTT
                      ____________________________________________________________
consensus ATGTCACTCAAGTTCAAATCCATAATGTGAAAAAGCCACAAGTGTAACTTCAAGGTCCTT
 
. : . : . : . : . : . :
JMFS025B11+ GTCTTTTGATTGTAGCTTTTCCAAATTGATTGATAGAGATGTTGTCACAACTTTGCTAAA
JMFS094D06+ GTCTTTTGATTGTAGCTTTTCCAAATTGATTGATAGAGATGTTGTCACAACTTTGCTAAA
                      ____________________________________________________________
consensus GTCTTTTGATTGTAGCTTTTCCAAATTGATTGATAGAGATGTTGTCACAACTTTGCTAAA
 
. : . : . : . : . : . :
JMFS025B11+ CGGTCAAGATAATATATTATATATATGCTTTTAAATAATTTGCTTTCTAGATCGATCTGA
JMFS094D06+ CGGTCAAGATAATATATTATATATATGCTTTTAAATAATTTGCTTTCTAGATCGATCTGA
                      ____________________________________________________________
consensus CGGTCAAGATAATATATTATATATATGCTTTTAAATAATTTGCTTTCTAGATCGATCTGA
 
. : . : . : . : . : . :
JMFS025B11+ TCTTGTGAAACAGAGATCTAGATAGCGTCCCCAAATTTTGGAGATAAATTGCCAAAGGAG
JMFS094D06+ TCTTGTGAAACAGAGATCTAGATAGCGTCCCCAAATTTTGGAGATAAATTGCCAAAGGAG
                      ____________________________________________________________
consensus TCTTGTGAAACAGAGATCTAGATAGCGTCCCCAAATTTTGGAGATAAATTGCCAAAGGAG
 
. : . : . : . : . : . :
JMFS025B11+ ATTTGCCCAAAAGACTTTTTTTTTTTTGTATTTATGGAATCTACTTAAAGACTCCAAAAT
JMFS094D06+ ATTTGCCCAAAAGACTTTTTTTTTTTTGTATTTATGGAATCTACTTAAAGACTCCAAAAT
                      ____________________________________________________________
consensus ATTTGCCCAAAAGACTTTTTTTTTTTTGTATTTATGGAATCTACTTAAAGACTCCAAAAT
 
. : . : . : . : . : . :
JMFS025B11+ GCTAAAGGAA
JMFS094D06+ GCTAAAGGAACTTTCCCACAGCTTAAATGAGTCTGGTATGAAATGCAAATTGAGTTCTTC
                      ____________________________________________________________
consensus GCTAAAGGAACTTTCCCACAGCTTAAATGAGTCTGGTATGAAATGCAAATTGAGTTCTTC
 
. : . : . : . : . : . :
JMFS094D06+ CTGACACAATTTGAAGTTGAAGCCCCAGTTCAGCAAAGAATCGGGTCATTCAGCAGGGAA
                      ____________________________________________________________
consensus CTGACACAATTTGAAGTTGAAGCCCCAGTTCAGCAAAGAATCGGGTCATTCAGCAGGGAA