Previous Contig 003614:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019H03Sequence545002935 (8)sp|P30924|GLGB_SOLTU1e-461,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz715003614 (5)gb:STY08786_17231867e-47Solanum tuberosum mRNA for 1,4-alpha-glucan branching enzyme.
JMFS068G03Sequence624003614 (5)gb:STY08786_17231861e-96Solanum tuberosum mRNA for 1,4-alpha-glucan branching enzyme.
JMFS093G06Sequence284003614 (5)
JMSF011L01Sequence433002935 (8)sp|P30924|GLGB_SOLTU1e-151,4-alpha-glucan branching enzyme (EC 2.4.1.18) (Starch branching enzyme) (Q-enz744003614 (5)gb:STY08786_17231862e-46Solanum tuberosum mRNA for 1,4-alpha-glucan branching enzyme.
JMSF018D09Sequence218002935 (8)796003614 (5)gb:STY08786_17231863e-49Solanum tuberosum mRNA for 1,4-alpha-glucan branching enzyme.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS068G03- GAAGCTTCTGT
                      ____________________________________________________________
consensus GAAGCTTCTGT
 
. : . : . : . : . : . :
JMFS068G03- TGTTGATCATGGAATTGCACTTGTCAAGATGATTCACTTTCTATCAATGAAATTTAGATA
                      ____________________________________________________________
consensus TGTTGATCATGGAATTGCACTTGTCAAGATGATTCACTTTCTATCAATGAAATTTAGATA
 
. : . : . : . : . : . :
JMFS068G03- CCCTTCTCCTCCTAATGCCATTGATAGGAGAAGGGTATCTAAATTTCATGGGAAATGAGT
                      ____________________________________________________________
consensus CCCTTCTCCTCCTAATGCCATTGATAGGAGAAGGGTATCTAAATTTCATGGGAAATGAGT
 
. : . : . : . : . : . :
JMFS068G03- TTGGCCATCCTGATTGGATTGACTTCCCTAGAGATGGCAACAACTGGAGTTATGAGAAGT
                      ____________________________________________________________
consensus TTGGCCATCCTGATTGGATTGACTTCCCTAGAGATGGCAACAACTGGAGTTATGAGAAGT
 
. : . : . : . : . : . :
JMFS068G03- GCAGACGCCAATGGAATCTTGTGGATACAAATCACTTGAGATACAAGTTCATGAATGCAT
                      ____________________________________________________________
consensus GCAGACGCCAATGGAATCTTGTGGATACAAATCACTTGAGATACAAGTTCATGAATGCAT
 
. : . : . : . : . : . :
JMFS068G03- TTGACAGGGCCATGAATTTGCTTGATGATGAGTTTTCCTTCCTTGCTTCAGAAAAACAGA
                      ____________________________________________________________
consensus TTGACAGGGCCATGAATTTGCTTGATGATGAGTTTTCCTTCCTTGCTTCAGAAAAACAGA
 
. : . : . : . : . : . :
JMFS068G03- TAGTAAGCAGCATAGATGAAGATAATAAGGTAATTGTATTTGAGCGTGGAGATCTGGTAT
rJMFF019H03+ GGTAT
rJMSF018D09+ GTAAGCAGCATAGATGAAGATAATAAGGTAATTGTA-TTGAGCGTGGAGATCTGGTAT
rJMSF011L01+ GGTAT
                      ____________________________________________________________
consensus TAGTAAGCAGCATAGATGAAGATAATAAGGTAATTGTATTTGAGCGTGGAGATCTGGTAT
 
. : . : . : . : . : . :
JMFS068G03- TTGTATTTAACTTTCATCCAGAGAATACATACGAGGGGTATAAAGTTGGATGCGACTTGC
rJMFF019H03+ TNGTATTTAACTTTCATCCAGAGAATACATACGAGGGGTATAAAGTTGGATGCGACTTGC
rJMSF018D09+ TTGTANTTAACTTTCATCCAGAGAATACATACGAGGGGTATAAAGTTGGATGCGACTTGC
rJMSF011L01+ TTGTATTTAACTTTCATCCAGAGAATACATACGAGGGGTATAAAGTTGGATGCGACTTGC
                      ____________________________________________________________
consensus TTGTATTTAACTTTCATCCAGAGAATACATACGAGGGGTATAAAGTTGGATGCGACTTGC
 
. : . : . : . : . : . :
JMFS068G03- CAGGTAAATACCGAGTTGCACTGGATAGTGATGCTTGGGCCTATGGTGGACATGGAAGGG
rJMFF019H03+ CAGGTAAATACCGAGTTGCACTGGATAGTGATGCTTGGGCCTATGGTGGACATGGAAGGG
rJMSF018D09+ CAGGTAAATACCGAGTTGCACTGGATAGTGATGCTTGGGCCTATGGTGGACATGGAAGGG
rJMSF011L01+ CAGGTAAATACCGAGTTGCACTGGATAGTGATGCTTGGGCCTATGGTGGACATGGAAGGG
                      ____________________________________________________________
consensus CAGGTAAATACCGAGTTGCACTGGATAGTGATGCTTGGGCCTATGGTGGACATGGAAGGG
 
. : . : . : . : . : . :
JMFS068G03- TGGGGCATGATGTAGAGCATTTCACATCACCTGAAGGAATACCTGGAGTTCCTGAAACAA
rJMFF019H03+ TGGGGCATGATGTAGAGCATTTCACATCACCTGAAGGAATACCTGGAGTTCCTGAAACAA
rJMSF018D09+ TGGGGCATGATGTAGAGCATTTCACATCACCTGAAGGAATACCTGGAGTTCCTGAAACAA
rJMSF011L01+ TGGGGCATGATGTAGAGCATTTCACATCACCTGAAGGAATACCTGGAGTTCCTGAAACAA
                      ____________________________________________________________
consensus TGGGGCATGATGTAGAGCATTTCACATCACCTGAAGGAATACCTGGAGTTCCTGAAACAA
 
. : . : . : . : . : . :
JMFS068G03- ATTTCAATGGTCGTCCAAACTCTTTCAAAGTACTATCTCCTCCTCAGGCATGCGTGGCCT
rJMFF019H03+ ATTTCAATGGTCGTCCAAACTCTTTCAAAGTACTATCTCCTCCTCAGGCATGCGTGGCCT
rJMSF018D09+ ATTTCAATGGTCGTCCAAACTCTTTCAAAGTACTATCTCCTCCTCAGGCATGCGTGGCCT
rJMSF011L01+ ATTTCAATGGTCGTCCAAACTCTTTCAAAGTACTATCTCCTCCTCAGGCATGCGTGGCCT
                      ____________________________________________________________
consensus ATTTCAATGGTCGTCCAAACTCTTTCAAAGTACTATCTCCTCCTCAGGCATGCGTGGCCT
 
. : . : . : . : . : . :
JMFS068G03- ATTACAGAGTTGA
rJMFF019H03+ ATTACAGAGTTGAAGAAAGCTTAGACGAAGTCCAAGATTCCAGTTTTACTGAGACTATAT
rJMSF018D09+ ATTACAGAGTTGAAGAAAGCTTAGACGAAGTCCAAGATTCCAGTTTTACTGAGACTATAT
rJMSF011L01+ ATTACAGAGTTGAAGAAAGCTTAGACGAAGTCCAAGATTCCAGTTTTACTGAGACTATAT
                      ____________________________________________________________
consensus ATTACAGAGTTGAAGAAAGCTTAGACGAAGTCCAAGATTCCAGTTTTACTGAGACTATAT
 
. : . : . : . : . : . :
rJMFF019H03+ CAACCAATCTAGTGTTGGTAAGTGATGACATTGGCGATCTTCAAGAATTGCCCACCGAAA
rJMSF018D09+ CAACCAATCTAGTGTTGGTAAGTGATGACATTGACGATCTTCAAGAATTGCCCACCGAAA
rJMSF011L01+ CAACCAATCTAGTGTTGGTAAGTGATGACATTGACGATCTTCAAGAATTGCCCACCGAAA
                      ____________________________________________________________
consensus CAACCAATCTAGTGTTGGTAAGTGATGACATTGACGATCTTCAAGAATTGCCCACCGAAA
 
. : . : . : . : . : . :
rJMFF019H03+ ATCTTCAGGAATTGCCTACCATGGGTAATAGTGATGATGTTGACGATCTTCAAGATTTGG
rJMSF018D09+ ATCTTCAGGAATTGCCTACCATGGGTAATAGTGATGATGTTGACGATCTTCAAGATTTGG
rJMSF011L01+ ATCTTCAGGAATTGCCTACCATGGGTAATAGTGATGATGTTGACGATCTTCAAGATTTGG
                      ____________________________________________________________
consensus ATCTTCAGGAATTGCCTACCATGGGTAATAGTGATGATGTTGACGATCTTCAAGATTTGG
 
. : . : . : . : . : . :
rJMFF019H03+ CTGCCATGGGTAATAGTGATGATCTTCAAGAATTGGGTAGCGTGGCTAATAGTATTAGTG
rJMSF018D09+ CTGCCATGGGTAATAGTGATGATCTTCAAGAATTGGGTAGCGTGGCTAATAGTATTAGTG
rJMSF011L01+ CTGCCATGGGTAATAGTGATGATCTTCAAGAATTGGGTAGCGTGGCTAATAGTATTAGTG
                      ____________________________________________________________
consensus CTGCCATGGGTAATAGTGATGATCTTCAAGAATTGGGTAGCGTGGCTAATAGTATTAGTG
 
. : . : . : . : . : . :
rJMFF019H03+ ATGTTGGGCAAAGAAAGGTTCAAGACCTGGAGGAGAACCCCCCGGATCTGGATGATGAGT
rJMSF018D09+ ATGTTGGGCAAAGAAAGGTTCAAGACCTGGAGGAGAACCCCCCGGATCTGGATGATGAGT
rJMSF011L01+ ATGTTGGGCAAAGAAAGGTTCAAGACCTGGAGGAGAACCCCCCGGATCTGGATGATGAGT
JMFS093G06+ GGTTCAAGACCTGGAGGAGAACCCCCCGGATCTGGATGATGAGT
                      ____________________________________________________________
consensus ATGTTGGGCAAAGAAAGGTTCAAGACCTGGAGGAGAACCCCCCGGATCTGGATGATGAGT
 
. : . : . : . : . : . :
rJMFF019H03+ CAGATTCTTGAGGCAGCTATCTATCTATCTATCTTTGAGCCATATTATATGTACAGATGG
rJMSF018D09+ CAGATTCTTGAGGCAGCTATCTATCTATCTATCTTTGAGCCATATTATATGTACAGATGG
rJMSF011L01+ CAGATTCTTGAGGCAGCTATCTATCTATCTATCTTTGAGCCATATTATATGTACAGATGG
JMFS093G06+ CAGATTCTTGAGGCAGCTATCTATCTATCTATCTTTGAGCCATATTATATGTACAGATGG
                      ____________________________________________________________
consensus CAGATTCTTGAGGCAGCTATCTATCTATCTATCTTTGAGCCATATTATATGTACAGATGG
 
. : . : . : . : . : . :
rJMFF019H03+ AAGAGAATCAAGGTTGTCTTGTTATGTTTGATGTTTTTAATTAGAATGGCTGTAAATTTA
rJMSF018D09+ AAGAGGATCAAGGTTGTCTTGTTATGTTTGATGTTTTTAATTAGAATGGCTGTAAATTTA
rJMSF011L01+ AAGAGAATCAAGGTTGTCTTGTTATGTTTGATGTTTTTAATTAGAATGGCTGTAAATTTA
JMFS093G06+ AAGAGAATCAAGGTTGTCTTGTTATGTTTGATGTTTTTAATTAGAATGGCTGTAAATTTA
                      ____________________________________________________________
consensus AAGAGAATCAAGGTTGTCTTGTTATGTTTGATGTTTTTAATTAGAATGGCTGTAAATTTA
 
. : . : . : . : . : . :
rJMFF019H03+ AATATAACCTTGTGAAACTGAATCCATCCATC-TTTGAAGTTGGTC
rJMSF018D09+ AATATAACCTTGTGAAACTGAATCCATCCATCTTTTGAAGTTGGTCCTTTAATTTGATGT
rJMSF011L01+ AATATAACCTTGTGAAACTGAATCCATCCATCTTTTGAAGTTGGTCCTTTAATTTGATGT
JMFS093G06+ AATATAACCTTGTGAAACTGAATCCATCCATCTTTTGAAGTTGGTCCTTTAATTTGATGT
                      ____________________________________________________________
consensus AATATAACCTTGTGAAACTGAATCCATCCATCTTTTGAAGTTGGTCCTTTAATTTGATGT
 
. : . : . : . : . : . :
rJMSF018D09+ CTGCAATAAAGCAACGGCT
rJMSF011L01+ CTGCAATAAAGCAACGGCT
JMFS093G06+ CTGCAATAAAGCAACGGCTTGTATAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTCTC
                      ____________________________________________________________
consensus CTGCAATAAAGCAACGGCTTGTATAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTCTC