Previous Contig 003607:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008B17Sequence594004863 (17)gb:BT002023_16356265e-74Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.772003607 (15)gb:AC092556_1735458e-109Oryza sativa chromosome 3 BAC OSJNBa0047E24 genomic sequence, complete sequence.
JMFF012K22Sequence543004863 (17)gb:BT002023_16356264e-64Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.704003607 (15)gb:AF377947_1793310e-103Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co
JMFF015D02Sequence609004863 (17)gb:BT002023_16356261e-72Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.758003607 (15)gb:AF377947_1793310e-100Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co
JMFF027E24Sequence547004863 (17)gb:BT002023_16356261e-64Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.696003607 (15)gb:AF377947_1793310e-103Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co
JMFF028F17Sequence539004863 (17)gb:AC092556_17354584e-55Oryza sativa chromosome 3 BAC OSJNBa0047E24 genomic sequence, complete sequence.704003607 (15)gb:BT002023_16356263e-91Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.
JMFF032A19Sequence533004863 (17)gb:BT002023_16356263e-62Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.645003607 (15)gb:BT002023_16356261e-90Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.
JMFF041A22Sequence635004863 (17)gb:BT002023_16356265e-76Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.620003607 (15)gb:BT002023_16356267e-85Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.
JMFF042B06Sequence640004863 (17)gb:BT002023_16356266e-81Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.585003607 (15)gb:BT002023_16356261e-73Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.
JMFF043L22Sequence641004863 (17)gb:BT002023_1635626e-108Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.646003607 (15)gb:AF377947_17933107e-69Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co
JMFF048O08Sequence445004863 (17)gb:BT002023_16356265e-46Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.317003607 (15)gb:AF377947_17933102e-29Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co
JMFF050D08Sequence636004863 (17)gb:BT002023_16356266e-81Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.584003607 (15)gb:AF377947_17933101e-71Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co
JMFS093A01Sequence353003607 (15)gb:BJU561120_16330563e-10Brassica juncea mRNA for glutathione transporter GT1 (gt1 gene).
JMSF007C21Sequence355004863 (17)gb:BT002023_16356262e-32Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.748003607 (15)gb:AF377947_1793310e-102Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co
JMSF027B15Sequence658004863 (17)gb:BT002023_16356265e-87Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.756003607 (15)gb:AF377947_1793310e-103Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co
JMSF045M19Sequence800004863 (17)gb:BT002023_1635626e-113Arabidopsis thaliana isp4 like protein (At4g16370) mRNA, complete cds.748003607 (15)gb:AF377947_1793310e-110Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, co

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008B17+ CGGGCACTATATGAAAA
                      ____________________________________________________________
consensus CGGGCACTATATGAAAA
 
. : . : . : . : . : . :
rJMFF027E24+ GGTGTAGTC
rJMSF045M19+ CCACGCAGCATGTATGTAGCTCAGCTGGTGGGAACACTCGTATCTGGTGTAGTC
rJMFF012K22+ GGTGTAGTC
rJMFF008B17+ TTCCTCCCACGCAGCATGTATGTAGCTCAGCTGGTGGGAACACTCGTATCTGGTGTAGTC
rJMSF007C21+ GGTGTAGTC
rJMSF027B15+ GTGTAGTC
                      ____________________________________________________________
consensus TTCCTCCCACGCAGCATGTATGTAGCTCAGCTGGTGGGAACACTCGTATCTGGTGTAGTC
 
. : . : . : . : . : . :
rJMFF027E24+ AACCTTGCGGTGTGCTGGTGGATGCTAGGTAGCATCGAAAACATTTGTGACACCGACGCA
rJMSF045M19+ AACCTTGCGGTGTGCTGGTGGATGCTAGGTAGCATCGAAAACATTTGTGACACCGACGCA
rJMFF012K22+ ANCCTTGCGGTGTGCTGGTGGATGCTAGGTAGCATCGAAAACATTTGTGACACCGACGCA
rJMFF008B17+ AACCTTGCGGTGTGCTGGTGGATGCTAGGTAGCATCGAAAACATTTGTGACACCGACGCA
rJMSF007C21+ ANCCTTGCGGTGTGCTGGTGGATGCTAGGTAGCATCGAAAACATTTGTGACACCGACGCA
rJMSF027B15+ AACCTTGCGGTGTGCTGGTGGATGCTAGGTAGCATCGAAAACATTTGTGACACCGACGCA
rJMFF028F17+ CA
rJMFF015D02+ CTGGTGGATGCTAGGTAGCATCGAAAACATTTGTGACACCGACGCA
                      ____________________________________________________________
consensus AACCTTGCGGTGTGCTGGTGGATGCTAGGTAGCATCGAAAACATTTGTGACACCGACGCA
 
. : . : . : . : . : . :
rJMFF027E24+ CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMSF045M19+ CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMFF012K22+ CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMFF008B17+ CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMSF007C21+ CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMSF027B15+ CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMFF028F17+ CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMFF032A19+ CAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMFF041A22+ CCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
rJMFF015D02+ CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
                      ____________________________________________________________
consensus CTTAGCCCCAACAGCCCATGGACGTGTCCCAAGTTCCGAGTCACTTTTGACGCGTCTGTG
 
. : . : . : . : . : . :
rJMFF027E24+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMSF045M19+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMFF012K22+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMFF008B17+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMSF007C21+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMSF027B15+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMFF028F17+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGGGGGTTGTATAGGAACCTG
rJMFF032A19+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMFF041A22+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMFF042B06+ CTGTTTGGACCGGGAGGGTNGTATAGGAACCTG
rJMFF050D08+ CTGTTTGGACCGGGAGGG-TGTATAGGAACCTG
rJMFF015D02+ ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
rJMFF043L22+ TG
                      ____________________________________________________________
consensus ATCTGGGGACTAATCGGGCCAAAACGGCTGTTTGGACCGGGAGGGTTGTATAGGAACCTG
 
. : . : . : . : . : . :
rJMFF027E24+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMSF045M19+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF012K22+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF008B17+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMSF007C21+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMSF027B15+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF028F17+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF032A19+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF041A22+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF042B06+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF050D08+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF015D02+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
rJMFF043L22+ GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
                      ____________________________________________________________
consensus GTTTGGCTATTCCTGATTGGAGCGGTGTTGCCCGTGCCTGTTTGGGTACTCAGCAAAATG
 
. : . : . : . : . : . :
rJMFF027E24+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMSF045M19+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF012K22+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF008B17+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMSF007C21+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMSF027B15+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF028F17+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF032A19+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF041A22+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF042B06+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF050D08+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF015D02+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
rJMFF043L22+ TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
                      ____________________________________________________________
consensus TTCCCAGAAAAGAAATGGATTCCTCTGATCAACATTCCCGTCATCTCGTACGGGTTTGCG
 
. : . : . : . : . : . :
rJMFF027E24+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMSF045M19+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF012K22+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF008B17+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMSF007C21+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMSF027B15+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF028F17+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF032A19+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF041A22+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF042B06+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF050D08+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF015D02+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
rJMFF043L22+ GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
                      ____________________________________________________________
consensus GGAATGCCGCCCGCAACTCCCACCAACATAGGTAGCTGGATTGTGACTGGGCTCATATTC
 
. : . : . : . : . : . :
rJMFF027E24+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMSF045M19+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF012K22+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF008B17+ AACTACTTTGTGTTCAAGTACTGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMSF007C21+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMSF027B15+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF028F17+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF032A19+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF041A22+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF042B06+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF050D08+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF048O08+ GGTGGTGGCAAAAGTACAATTACGTCCTTTCG
rJMFF015D02+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
rJMFF043L22+ AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
                      ____________________________________________________________
consensus AACTACTTTGTGTTCAAGTACAGGAAAGGGTGGTGGCAAAAGTACAATTACGTCCTCTCG
 
. : . : . : . : . : . :
rJMFF027E24+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMSF045M19+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF012K22+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF008B17+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMSF007C21+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMSF027B15+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF028F17+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF032A19+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF041A22+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF042B06+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF050D08+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF048O08+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF015D02+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
rJMFF043L22+ GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
                      ____________________________________________________________
consensus GCTGCCCTCGATGCGGGTACGGCTTTCATGGCCGTGCTGCTGTTTTTCGCGTTACAGAAC
 
. : . : . : . : . : . :
rJMFF027E24+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMSF045M19+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF012K22+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF008B17+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTAGACCACTGCCCTCTCGCATCTTGC
rJMSF007C21+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMSF027B15+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF028F17+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF032A19+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF041A22+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF042B06+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF050D08+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF048O08+ GAGCATAAAGAGTTGAAGTGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF015D02+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
rJMFF043L22+ GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
JMFS093A01+ TAAAAAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATTTTGC
                      ____________________________________________________________
consensus GAGCATAAAGAGTTGAAATGGTGGGGGTCGGAGCTCGACCACTGCCCTCTCGCATCTTGC
 
. : . : . : . : . : . :
rJMFF027E24+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMSF045M19+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF012K22+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF008B17+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMSF007C21+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMSF027B15+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF028F17+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF032A19+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF041A22+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF042B06+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF050D08+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF048O08+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF015D02+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
rJMFF043L22+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
JMFS093A01+ CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAAA
                      ____________________________________________________________
consensus CCAACGGCTCCTGGGATTGTGGTTGAAGGTTGCCCAGTTTTCAAGTAGGCAAGTAGCAGA
 
. : . : . : . : . : . :
rJMFF027E24+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMSF045M19+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF012K22+ GCAGCCATGTAAATTGCTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF008B17+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMSF007C21+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMSF027B15+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF028F17+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF032A19+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF041A22+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF042B06+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF050D08+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF048O08+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF015D02+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
rJMFF043L22+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
JMFS093A01+ GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
                      ____________________________________________________________
consensus GCAGCCATGTAAATTGTTTCATACAATTTCTTACATTGCATCTTATTAGGGTATTAGTGA
 
. : . : . : . : . : . :
rJMFF027E24+ ATCTATTTGTTAAACACAATAATA
rJMSF045M19+ ATCTATTTGTTAAACACAATAATATATGCGCAAC
rJMFF012K22+ ATCTATTTGTTAAACACAATAATATATGCGCAACA
rJMFF008B17+ ATCTATTTGTTAAACACAATAATATATGCGCAACA
rJMSF007C21+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAACCACCTTGGATTT
rJMSF027B15+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAACCA-CTTGGATTT
rJMFF028F17+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAACCA-CTTGGATTT
rJMFF032A19+ ATCTATTTGTTAAACACAATAATATATGCGCAACAG-TTTGGAATAACCA-CT
rJMFF041A22+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAA
rJMFF042B06+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAACCA-CTTGGATTT
rJMFF050D08+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAACCA-CTTGGATTT
rJMFF048O08+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAAT
rJMFF015D02+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAACCA-CTTGGATTT
rJMFF043L22+ ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAACCA-CTTGGATTT
JMFS093A01+ ATCTATTTGTTAAACCCAATAATATATGCGCAACAGTTTTGGAATAACCC-CTTGGATTT
                      ____________________________________________________________
consensus ATCTATTTGTTAAACACAATAATATATGCGCAACAGTTTTGGAATAACCA-CTTGGATTT
 
. : . : . : . : . : . :
rJMSF007C21+ TATATTTCTGTGGCAACTT
rJMSF027B15+ TATA-TTCTGTGGCAACTTTGGTT
rJMFF028F17+ TATA-TTCTGTGGCAACTTTGGTTTGCAAATTATTATTT
rJMFF042B06+ TATA-TTCTGTGGC
rJMFF050D08+ TATA-TTCTGTGGC
rJMFF015D02+ TATA-TTCTGTGGCAACTTTGGTTTGCAAATTATTATTTTACCAATACAACAGC
rJMFF043L22+ TATA-TTCTGTGGCAACTTTGGTTTGCAAATTATTATTTTACCAATACAACAGCGTTTTT
JMFS093A01+ TATA-TTCTGTGGCAACTTTGGTTTGCAAATTATTATTTTACCAATACAACAGCGTTTTT
                      ____________________________________________________________
consensus TATA-TTCTGTGGCAACTTTGGTTTGCAAATTATTATTTTACCAATACAACAGCGTTTTT
 
. : . : . : . : . : . :
rJMFF043L22+ GAGCC
JMFS093A01+ GAGCCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCTCGAGACTAGT
                      ____________________________________________________________
consensus GAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCGAGACTAGT