Previous Contig 003601:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020M14Sequence511003601 (12)sp|P27774|KPPR_MESCR2e-89Phosphoribulokinase, chloroplast precursor (EC 2.7.1.19) (Phosphopentokinase) (P740003601 (12)gb:AF529237_18090321e-92Oryza sativa (indica cultivar-group) phosphoribulokinase precursor mRNA, complet
JMFF023D09Sequence446003601 (12)gb:NTA496226_16914195e-38Nicotiana tabacum mRNA for putative rac protein (rac2 gene).>gb:NTU64924_1691870704003601 (12)gb:AF529237_18090324e-98Oryza sativa (indica cultivar-group) phosphoribulokinase precursor mRNA, complet
JMFN002E02Sequence492003601 (12)gb:AF529237_18090322e-31Oryza sativa (indica cultivar-group) phosphoribulokinase precursor mRNA, complet
JMFN018C07Sequence590003601 (12)gb:NTA496226_16914191e-84Nicotiana tabacum mRNA for putative rac protein (rac2 gene).>gb:NTU64924_1691870
JMFS092C06Sequence594003601 (12)gb:NTA496226_16914191e-84Nicotiana tabacum mRNA for putative rac protein (rac2 gene).>gb:NTU64924_1691870
JMFS161E01Sequence561003601 (12)sp|P27774|KPPR_MESCR8e-99Phosphoribulokinase, chloroplast precursor (EC 2.7.1.19) (Phosphopentokinase) (P
JMSF011L09Sequence478003601 (12)sp|P25697|KPPR_ARATH5e-25Phosphoribulokinase, chloroplast precursor (EC 2.7.1.19) (Phosphopentokinase) (P744003601 (12)gb:AF529237_1809032e-107Oryza sativa (indica cultivar-group) phosphoribulokinase precursor mRNA, complet
JMSF048J20Sequence680003601 (12)sp|P27774|KPPR_MESCR4e-70Phosphoribulokinase, chloroplast precursor (EC 2.7.1.19) (Phosphopentokinase) (P721003601 (12)gb:AF529237_1809032e-108Oryza sativa (indica cultivar-group) phosphoribulokinase precursor mRNA, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN002E02+ AGATTCATGCATGGCTTCACCAT
                      ____________________________________________________________
consensus AGATTCATGCATGGCTTCACCAT
 
. : . : . : . : . : . :
JMFN002E02+ TTTTTTTTGTTTTTCTTTTGCTTATCTATCTTTGAGAGGCAGCTGGAAGTAAATACACAT
                      ____________________________________________________________
consensus TTTTTTTTGTTTTTCTTTTGCTTATCTATCTTTGAGAGGCAGCTGGAAGTAAATACACAT
 
. : . : . : . : . : . :
JMFN002E02+ GGACTGTTTCTCATTTATGGGGGATCATATCATATCATATCACCTAACTCTCTCTCAAGT
rJMFF020M14- GGACTGTTTCTC-TTTATGGGGGATCATATCATATCATATCACCTAACTCTCTCTCAAGT
rJMFF023D09- TCATATCACCTAACTCTCTCTCAAGT
rJMSF011L09- TCATATCACCTAACTCTCTCTCAAGT
                      ____________________________________________________________
consensus GGACTGTTTCTCATTTATGGGGGATCATATCATATCATATCACCTAACTCTCTCTCAAGT
 
. : . : . : . : . : . :
JMFN002E02+ GGAATTACATGAAAGATGAGAAAGAAAACCTAAATGAAAAGTGAAAACCACAGAGAAGTG
rJMFF020M14- GGAATTACATGAAAGATGAGAAAGAAAACCTANATGAAAAGTGAAAACCACAGAGAAGTG
rJMFF023D09- GGAATTACATGAAAGATGAGAAAGAAAACCTAAATGAAAAGTGAAAACCACAGAGAAGTG
rJMSF011L09- GGAATTACATGAAAGATGAGAAAGAAAACCTAAATGAAAAGTGAAAACCACAGAGAAGTG
rJMSF048J20- CATGAAAGATGAGAAAGAAAACCTAAATGAAAAGTGAAAACCACAGAGAAGTG
                      ____________________________________________________________
consensus GGAATTACATGAAAGATGAGAAAGAAAACCTAAATGAAAAGTGAAAACCACAGAGAAGTG
 
. : . : . : . : . : . :
JMFN002E02+ ATGAGAAAGGGAAAGAGTAATGAATTTGGGCGAATTTTTTTAGGCCTTGGCTTCCACTGG
rJMFF020M14- ATGAGAAAGGGAAAGAGTAATGAATTTGGGCGAATTTTTTTAGGCCTTGGCTTCCACTGG
rJMFF023D09- ATGAGAAAGGGAAAGAGTAATGAATTTGGGCGAATTTTTTTAGGCCTTGGCTTCCACTGG
rJMSF011L09- ATGAGAAAGGGAAAGAGTAATGAATTTGGGCGAATTTTTTTAGGCCTTGGCTTCCACTGG
rJMSF048J20- ATGAGAAAGGGAAAGAGTAATGAATTTGGGCGAATTTTTTTAGGCCTTGGCTTCCACTGG
                      ____________________________________________________________
consensus ATGAGAAAGGGAAAGAGTAATGAATTTGGGCGAATTTTTTTAGGCCTTGGCTTCCACTGG
 
. : . : . : . : . : . :
JMFN002E02+ AGCTGCAGCCCGGGTGGCAACGATCTGCTCATACAGATCCCTGATCTTCAACCCAACAAT
rJMFF020M14- AGCTGCAGCCCGGGTGGCAACGATCTGCTCATACAGATCCCTGATCTTCAACCCAACAAT
rJMFF023D09- AGCTGCAGCCCGGGTGGCAACGATCTGCTCATACAGATCCCTGATCTTCAACCCAACAAT
rJMSF011L09- AGCTGCAGCCCGGGTGGCAACGATCTGCTCATACAGATCCCTGATCTTCAACCCAACAAT
rJMSF048J20- AGCTGCAGCCCGGGTGGCAACGATCTGCTCATACAGATCCCTGATCCTCAACCCAACAAT
                      ____________________________________________________________
consensus AGCTGCAGCCCGGGTGGCAACGATCTGCTCATACAGATCCCTGATCTTCAACCCAACAAT
 
. : . : . : . : . : . :
JMFN002E02+ GGTCTGGAAGAAGCCTGTTCCATTGTTGCTCCCCGGGAAGTCGGCGTGCTTCAGCATTTG
rJMFF020M14- GGTCTGGAAGAAGCCTGTTCCATTGTTGCTCCCCGGGAAGTCGGCGTGCTTCAGCATTTG
rJMFF023D09- GGTCTGGAAGAAGCCTGTTCCATTGTTGCTCCCCGGGAAGTCGGCGTGCTTCAGCATTTG
rJMSF011L09- GGTCTGGAAGAAGCCTGTTCCATTGTTGCTCCCCGGGAAGTCGGCGTGCTTCAGCATTTG
rJMSF048J20- GGTCTGGAAGAAGCCTGTTCCATTGTTGCTCCCCGGGAAGTCGGCGTGCTTCAGCATTTG
                      ____________________________________________________________
consensus GGTCTGGAAGAAGCCTGTTCCATTGTTGCTCCCCGGGAAGTCGGCGTGCTTCAGCATTTG
 
. : . : . : . : . : . :
JMFN002E02+ C--TGTCACTTCACCATAGAATTTGGTGGAGAGGCTGCTCAAATGGCTCTCAACATAGAT
rJMFF020M14- CTGTGTCACTTCACCATAGAATTTGGTGGAGAGGCTGCTCAAATGGCTCTCAACATAGAT
rJMFF023D09- CTGTGTCACTTCACCATAGAATTTGGTGGAGAGGCTGCTCAAATGGCTCTCAACATAGAT
rJMSF011L09- CTGTGTCACTTCACCATAGAATTTGGTGGAGAGGCTGCTCAAATGGCTCTCAACATAGAT
rJMSF048J20- CTGTGTCACTTCACCATAGAATTTGGTGGAGAGGCTGCTCAAATGGCTCTCAACATAGAT
                      ____________________________________________________________
consensus CTGTGTCACTTCACCATAGAATTTGGTGGAGAGGCTGCTCAAATGGCTCTCAACATAGAT
 
. : . : . : . : . : . :
JMFN002E02+ CAGCTCATCTAGTCTGTCAAACTGCCCGTCCATCTCCAGCACAGACACCTC
rJMFF020M14- CAGCTCATCTAGTCTGTCAAACTGCCCGTCCATCTCCAGCACAGACACCTCATGGCCAAA
rJMFF023D09- CAGCTCATCTAGTCTGTCAAACTGCCCGTCCATCTCCAGCACAGACACCTCATGGCCAAA
rJMSF011L09- CAGCTCATCTAGTCTGTCAAACTGCCCGTCCATCTCCAGCACAGACACCTCATGGCCAAA
rJMSF048J20- CAGCTCATCTAGTCTGTCAAACTGCCCGTCCATCTCCAGCACAGACACCTCATGGCCAAA
                      ____________________________________________________________
consensus CAGCTCATCTAGTCTGTCAAACTGCCCGTCCATCTCCAGCACAGACACCTCATGGCCAAA
 
. : . : . : . : . : . :
rJMFF020M14- GTATGTGTCGGGTCCATANGTGAACTTGATCCCGGGGTAAGAACAGGTCANCTTTCGCCC
rJMFF023D09- GTATGTGTCGGGTCCATAGGTGAACTTGATCCCGGGGTAAGAACAGGTCAGCTTTCGCCC
rJMSF011L09- GTATGTGTCGGGTCCATAGGTGAACTTGATCCCGGGGTAAGAACAGGTCAGCTTTCGCCC
rJMSF048J20- GTATGTGTCGGGTCCATAGGTGAACTTGATCCCGGGGTAAGAACAGGTCAGCTTTCGCCC
                      ____________________________________________________________
consensus GTATGTGTCGGGTCCATAGGTGAACTTGATCCCGGGGTAAGAACAGGTCAGCTTTCGCCC
 
. : . : . : . : . : . :
rJMFF020M14- GCAAGGGATCCATGANATAGTAGACCCTTCATCAAAGAGGTAAACCGGGCTGAAATGCTT
rJMFF023D09- GCAAGGGATCCATGAGATAGTAGACCCTTCATCAAAGAGGTAAACCGGGCTGAAATGCTT
rJMSF011L09- GCAAGGGATCCATGAGATAGTAGACCCTTCATCAAAGAGGTAAACCGGGCTGAAATGCTT
rJMSF048J20- GCAAGGGATCCATGAGATAGTAGACCCTTCATCAAAGAGGTAAACCGGGCTGAAATGCTT
                      ____________________________________________________________
consensus GCAAGGGATCCATGAGATAGTAGACCCTTCATCAAAGAGGTAAACCGGGCTGAAATGCTT
 
. : . : . : . : . : . :
rJMFF020M14- CACCCCTTCTTTCATTATCAACCTCA--CTCAACACCTTGCCCTCATTGTCATCTGGAAT
rJMFF023D09- CACCCCTTCTTTCATTATCAACCTCACTCTCAACACCTTGCCCTCATTGTCATCTGGAAT
rJMSF011L09- CACCCCTTCTTTCATTATCAACCTCACTCTCAACACCTTGCCCTCATTGTCATCTGGAAT
rJMSF048J20- CACCCCTTCTTTCATTATCAACCTCACTCTCAACACCCTGCCCTCATTGTCATCTGGAAT
JMFS161E01+ TTTCATTATCAACCTCACTCTCAACACCTTGCCCTCATTGTCATCTGGAAT
                      ____________________________________________________________
consensus CACCCCTTCTTTCATTATCAACCTCACTCTCAACACCTTGCCCTCATTGTCATCTGGAAT
 
. : . : . : . : . : . :
rJMFF020M14- CAACTGCGTCGGCAGCACCTCTATAACCGCATCTGCATATTGTTTCTGCGGGTCAATGTA
rJMFF023D09- CAACTGCGTCGGCAGCACCTCTATAACCGCATCTGCATATTGTTTCTGCGGGTCAATGTA
rJMSF011L09- CAACTGCGTCGGCAGCACCTCTATAACCGCATCTGCATATTGTTTCTGCGGGTCAATGTA
rJMSF048J20- CAACTGCGTCGGCAGCACCTCTATAACCGCATCTGCATATTGTTTCTGCGGGTCAATGTA
JMFS161E01+ CAACTGCGTCGGCAGCACCTCTATAACCGCATCTGCATATTGTTTCTGCGGGTCAATGTA
                      ____________________________________________________________
consensus CAACTGCGTCGGCAGCACCTCTATAACCGCATCTGCATATTGTTTCTGCGGGTCAATGTA
 
. : . : . : . : . : . :
rJMFF020M14- GGCATCAAAGTCTGGCTTCCTGGCCTCTATGCTGGCTTTGATGCTCTCAANGCTGTGCCC
rJMFF023D09- GGCATCAAAGTCTGGCTTCCTGGCCTCTATGCTGGCTTTGATGCTCTCAAGGCTGTGCCC
rJMSF011L09- GGCATCAAAGTCTGGCTTCCTGGCCTCTATGCTGGCTTTGATGCTCTCAAGGCTGTGCCC
rJMSF048J20- GGCATCAAAGTCTGGCTTCCTGGCCTCTATGCTGGCTTTGATGCTCTCAAGGCTGTGCCC
JMFS161E01+ GGCATCAAAGTCTGGCTTCCTGGCCTCTATGCTGGCTTTGATGCTCTCAAGGCTGTGCCC
JMFF020M14+ GCCTCTATGCTGGCTTTGATGCTCTCAAGGCTGTGCCC
                      ____________________________________________________________
consensus GGCATCAAAGTCTGGCTTCCTGGCCTCTATGCTGGCTTTGATGCTCTCAAGGCTGTGCCC
 
. : . : . : . : . : . :
rJMFF020M14- TCTTTCAGNCATATCTCTCTGGA
rJMFF023D09- TCTTTCA
rJMSF011L09- TCTTTCAGCCATATCTCTCTGGATTTTCCATGCAAACTTAACTTCATTGCTGATAT
rJMSF048J20- TCTTTCAGCCATATCTCTCTGGATTTTCCATGCAAACTTAACTTCATTGCTGATATCCNA
JMFS161E01+ TCTTTCAGCCATATCTCTCTGGATTTTCCATGCAAACTTAACTTCATTGCTGATATCCAA
JMFF020M14+ TCTTTCAGCCATATCTCTCTGGATTTTCCATGCAAACTTAACTTCATTGCTGATATCCAA
JMSF048J20+ GCTGATATCCAA
                      ____________________________________________________________
consensus TCTTTCAGCCATATCTCTCTGGATTTTCCATGCAAACTTAACTTCATTGCTGATATCCAA
 
. : . : . : . : . : . :
rJMSF048J20- GTAGATAC
JMFS161E01+ GTAGATACTGAAGTCCAAGAGCTCTCTCACACGAGCATCATACATGGGGTGCAATCCTTC
JMFF020M14+ GTAGATACTGAAGTCCAAGAGCTCTCTCACACGAGCATCATACATGGGGTGCAATCCTTC
JMSF048J20+ GTAGATACTGAAGTCCAAGAGCTCTCTCACACGAGCATCATACATGGGGTGCAATCCTTC
                      ____________________________________________________________
consensus GTAGATACTGAAGTCCAAGAGCTCTCTCACACGAGCATCATACATGGGGTGCAATCCTTC
 
. : . : . : . : . : . :
JMFS161E01+ AATGACAAGAATCTTGGGGGGTTTGGTAAGCTCAGGGGGATCAAGAAGGCCAGTAACGTG
JMFF020M14+ AATGACAAGAATCTTGGGGGGTTTGGTAAGCTCAGGGGGATCAAGAAGGCCAGTAACGTG
JMSF048J20+ AATGACAAGAATCTTGGGGGGTTTGGTAAGCTCAGGGGGATCAAGAAGGCCAGTAACGTG
                      ____________________________________________________________
consensus AATGACAAGAATCTTGGGGGGTTTGGTAAGCTCAGGGGGATCAAGAAGGCCAGTAACGTG
 
. : . : . : . : . : . :
JMFS161E01+ ATTATAAATAGGCTTATCAACGGCTTTACCTTCCTTCAAAGCTTTAACCTGTTCATACAT
JMFF020M14+ ATTATAAATAGGCTTATCAACGGCTTTACCTTCCTTCAAAGCTTTAACCTGTTCATACAT
JMSF048J20+ ATTATAAATAGGCTTATCAACGGCTTTACCTTCCTTCAAAGCTTTAACCTGTTCATACAT
                      ____________________________________________________________
consensus ATTATAAATAGGCTTATCAACGGCTTTACCTTCCTTCAAAGCTTTAACCTGTTCATACAT
 
. : . : . : . : . : . :
JMFS161E01+ GAGATCAAAATCGTTAGCTCTGGGGTCAAGAGCCGTCACTCCTTTCTCCTTCCTCCCGGT
JMFF020M14+ GAGATCAAAATCGTTAGCTCTGGGGTCAAGAGCCGTCACTCCTTTCTCCTTCCTCCCGGT
JMSF048J20+ GAGATCAAAATCGTTAGCTCTGGGGTCAAGAGCCGTCACTCCTTTCTCCTTCCTCCCGGT
                      ____________________________________________________________
consensus GAGATCAAAATCGTTAGCTCTGGGGTCAAGAGCCGTCACTCCTTTCTCCTTCCTCCCGGT
 
. : . : . : . : . : . :
JMFS161E01+ CCTGTCAAGAGAATGGTAGTCGTCTAAGCATATCACGGTGGTCATGTCGCTGATGAGCGT
JMFF020M14+ CCTGTCAAGAGAATGGTAGTCGTCTAAGCATATCACGGTGGTCATGTCGCTGATGAGCGT
JMSF048J20+ CCTGTCAAGAGAATGGTAGTCGTCTAAGCATATCACGGTGGTCATGTCGCTGATGAGCGT
JMSF011L09+ CCTGTCAAGAGAATGGTAGTCGTCTAAGCATATCACGGTGGTCATGTCGCTGATGAGCGT
                      ____________________________________________________________
consensus CCTGTCAAGAGAATGGTAGTCGTCTAAGCATATCACGGTGGTCATGTCGCTGATGAGCGT
 
. : . : . : . : . : . :
JMFS161E01+ GTTGGAGTCCGGGTTTCCGCCCTTGGGCGG
JMFF020M14+ GTTGGAGTCCGGGTTTCCGCCCTTGGGCGGCTCCGCCGCGCCGCCGAACACGCTGGTCAG
JMSF048J20+ GTTGGAGTCCGGGTTTCCGCCCTTGGGCGGNTCCGCCGCGCCGCCGAACACGCTGGTCAG
JMSF011L09+ GTTGGAGTCCGGGTTTCCGCCCTTGGGCGGNTCCGCCGCGCCGCCGAACACGCTGGTCAG
                      ____________________________________________________________
consensus GTTGGAGTCCGGGTTTCCGCCCTTGGGCGGCTCCGCCGCGCCGCCGAACACGCTGGTCAG
 
. : . : . : . : . : . :
JMFF020M14+ CCGCCGCATGAACGTGCTCTTCCCGCACCCCGAGTCCGCCGCCAGGCCTATCA
JMSF048J20+ CCGCCGCATGAACGTGCTCTTCCCGCACCCCGAGTCCGCCGCCAGGCCTATCACCACCGT
JMSF011L09+ CCGCCGCATGAACGTGCTCTTCCCGCACCCCGAGTCCGCCGCCAGGCCTATCACCACCGT
                      ____________________________________________________________
consensus CCGCCGCATGAACGTGCTCTTCCCGCACCCCGAGTCCGCCGCCAGGCCTATCACCACCGT
 
. : . : . : . : . : . :
JMSF048J20+ CTTGCCGTCGCCCCCGGCGGCGGCGCACGAAATTCCCACCTTCCTAGCGCTCTTTTTGTA
JMSF011L09+ CTTGCCGTCGCCCCCGGCGGCGGCGCACGAAATTCCCACCTTCCTAGCGCTCTTTTTGTA
                      ____________________________________________________________
consensus CTTGCCGTCGCCCCCGGCGGCGGCGCACGAAATTCCCACCTTCCTAGCGCTCTTTTTGTA
 
. : . : . : . : . : . :
JMSF048J20+ GACAAAAACCTGTCTTTGGAAGTGGGTTTTGGTGGGCGTGGAGATTGAACATGTTGAGTG
JMSF011L09+ GACAAAAACCTGTCTTTGGAAGTGGGTTTTGGTGGGCGTGGAGATTGAACATGTTGAGTG
JMFF023D09+ GGTTTTGGTGGGCGTGGAGATTGAACATGTTGAGTG
                      ____________________________________________________________
consensus GACAAAAACCTGTCTTTGGAAGTGGGTTTTGGTGGGCGTGGAGATTGAACATGTTGAGTG
 
. : . : . : . : . : . :
JMSF048J20+ GAGGGATTGAACAGTGTACACTGTGCAAACTGCCATTGTTCTTTCTCTTCTGGGAAAATG
JMSF011L09+ GAGGGATTGAACAGTGTACACTGTGCAAACTGCCATTGTTCTTTCTCTTCTGGGAAAATG
JMFF023D09+ GAGGGATTGAACAGTGTACACTGTGCAAACTGCCATTGTTCTTTCTCTTCTGGGAAAATG
                      ____________________________________________________________
consensus GAGGGATTGAACAGTGTACACTGTGCAAACTGCCATTGTTCTTTCTCTTCTGGGAAAATG
 
. : . : . : . : . : . :
JMSF048J20+ TTCAGAGAGAAATGGCAGATAATAATGGAAGGTGTGGATATAAGTGGCTTAAGCTGATGA
JMSF011L09+ TTCAGAGAGAAATGGCAGATAATAATGGAAGGTGTGGATATAAGTGGCTTAAGCTGATGA
JMFF023D09+ TTCAGAGAGAAATGGCAGATAATAATGGAAGGTGTGGATATAAGTGGCTTAAGCTGATGA
                      ____________________________________________________________
consensus TTCAGAGAGAAATGGCAGATAATAATGGAAGGTGTGGATATAAGTGGCTTAAGCTGATGA
 
. : . : . : . : . : . :
JMSF048J20+ CATGAAT
JMSF011L09+ CATGAATAAGAGCTAAGAGCTAAGAAAGTGGTTTATGGCTGAGGTTAGAGAAATCATC
JMFF023D09+ CATGAATAAGAGCTAAGAGCTAAGAAAGTGGTTTATGGCTGAGGTTAGAGAAATCATCCC
JMFN018C07+ CCC
JMFS092C06+ CCC
                      ____________________________________________________________
consensus CATGAATAAGAGCTAAGAGCTAAGAAAGTGGTTTATGGCTGAGGTTAGAGAAATCATCCC
 
. : . : . : . : . : . :
JMFF023D09+ TGAGCCATGGTAATAGGTATTGCTCCAGGGTGATCTAAGAAAAACTGCTTATCCTCTCGG
JMFN018C07+ TGAGCCATGGTAATAGGTATTGCTCCAGGGTGATCTAAGAAAAACTGCTTATCCTCTCGG
JMFS092C06+ TGAGCCATGGTAATAGGTATTGCTCCAGGGTGATCTAAGAAAAACTGCTTATCCTCTCGG
                      ____________________________________________________________
consensus TGAGCCATGGTAATAGGTATTGCTCCAGGGTGATCTAAGAAAAACTGCTTATCCTCTCGG
 
. : . : . : . : . : . :
JMFF023D09+ AGATCTAGCTTTGTTCCAACAAGAATAATTGGCACTCCTGGTGCGTAATGCCTCAATTCA
JMFN018C07+ AGATCTAGCTTTGTTCCAACAAGAATAATTGGCACTCCTGGTGCGTAATGCCTCAATTCA
JMFS092C06+ AGATCTAGCTTTGTTCCAACAAGAATAATTGGCACTCCTGGTGCGTAATGCCTCAATTCA
                      ____________________________________________________________
consensus AGATCTAGCTTTGTTCCAACAAGAATAATTGGCACTCCTGGTGCGTAATGCCTCAATTCA
 
. : . : . : . : . : . :
JMFF023D09+ GGAATCCACTTTTTGGATACATTTTCATAGCTGGCCTTGCTAATGAGCGAAAATGCCAGA
JMFN018C07+ GGAATCCACTTTTTGGATACATTTTCATAGCTGGCCTTGCTAATGAGCGAAAATGCCAGA
JMFS092C06+ GGAATCCACTTTTTGGATACATTTTCATAGCTGGCCTTGCTAATGAGCGAAAATGCCAGA
                      ____________________________________________________________
consensus GGAATCCACTTTTTGGATACATTTTCATAGCTGGCCTTGCTAATGAGCGAAAATGCCAGA
 
. : . : . : . : . : . :
JMFF023D09+ ATAAAGACATCTGCTCCACGATAGCTCAAAGGTCTCAATCTATTGTAATC
JMFN018C07+ ATAAAGACATCTGCTCCACGATAGCTCAAAGGTCTCAATCTATTGTAATCCTCTTGTCCT
JMFS092C06+ ATAAAGACATCTGCTCCACGATAGCTCAAAGGTCTCAATCTATTGTAATCCTCTTGTCCT
                      ____________________________________________________________
consensus ATAAAGACATCTGCTCCACGATAGCTCAAAGGTCTCAATCTATTGTAATCCTCTTGTCCT
 
. : . : . : . : . : . :
JMFN018C07+ GCAGTATCCCACAGCCCTAGATTAACAGTATTCCCATCCACAACCACATTGGCACTGAAG
JMFS092C06+ GCAGTATCCCACAGCCCTAGATTAACAGTATTCCCATCCACAACCACATTGGCACTGAAG
                      ____________________________________________________________
consensus GCAGTATCCCACAGCCCTAGATTAACAGTATTCCCATCCACAACCACATTGGCACTGAAG
 
. : . : . : . : . : . :
JMFN018C07+ TTGTCAAAAACGGTTGGGACATAGTCAGTGGGAAAAGTGTTGCTGGTGTAGGAGATGAGG
JMFS092C06+ TTGTCAAAAACGGTTGGGACATAGTCAGTGGGAAAAGTGTTGCTGGTGTAGGAGATGAGG
                      ____________________________________________________________
consensus TTGTCAAAAACGGTTGGGACATAGTCAGTGGGAAAAGTGTTGCTGGTGTAGGAGATGAGG
 
. : . : . : . : . : . :
JMFN018C07+ AGGCAAGTTTTACCGACAGCTCCGTCGCCGACGGTGACGCACTTTATGAACCGAGAGGCG
JMFS092C06+ AGGCAAGTTTTACCGACAGCTCCGTCGCCGACGGTGACGCACTTTATGAACCGAGAGGCG
                      ____________________________________________________________
consensus AGGCAAGTTTTACCGACAGCTCCGTCGCCGACGGTGACGCACTTTATGAACCGAGAGGCG
 
. : . : . : . : . : . :
JMFN018C07+ CTCATTCTGGCAGAGCCAAAGAGTCCAACTTCTCAGGCAGCCCCTCCACTTGGCTTGTTT
JMFS092C06+ CTCATTCTGGCAGAGCCAAAGAGTCCAACTTCTCAGGCAGCCCCTCCACTTGGCTTGTTT
                      ____________________________________________________________
consensus CTCATTCTGGCAGAGCCAAAGAGTCCAACTTCTCAGGCAGCCCCTCCACTTGGCTTGTTT
 
. : . : . : . : . : . :
JMFN018C07+ CTTCTTCTTCTTCTCCTGCTTTCTGGAGACCAGCTTCTTCTCTCTACCCCTTTCTC
JMFS092C06+ CTTCTTCTTCTTCTCCTGCTTTCTGGAGACCAGCTTCTTCTCTCTACCCCTTTCTCTCTC
                      ____________________________________________________________
consensus CTTCTTCTTCTTCTCCTGCTTTCTGGAGACCAGCTTCTTCTCTCTACCCCTTTCTCTCTC