Previous Contig 003600:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS037F07Sequence425003600 (4)gb:AP005162_18485022e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFS092C02Sequence612003600 (4)gb:AP005162_18485022e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFS114E07Sequence566003600 (4)gb:AP005162_18485023e-50Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMFS136F01Sequence573003600 (4)gb:AB041352_15196662e-59Nicotiana tabacum cig3 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS136F01+ TAGTTC
                      ____________________________________________________________
consensus TAGTTC
 
. : . : . : . : . : . :
JMFS136F01+ TGTCGATTCTTCTCAAATGCAATAATCAAGTTGTCCCTTGCAGTGGTGAAGGGGTTCTCT
                      ____________________________________________________________
consensus TGTCGATTCTTCTCAAATGCAATAATCAAGTTGTCCCTTGCAGTGGTGAAGGGGTTCTCT
 
. : . : . : . : . : . :
JMFS136F01+ ACAGCAAGACTTCGAAAATATCGATAAATTGCCACCAATTCATCACCAGAGTAGGAAGCC
                      ____________________________________________________________
consensus ACAGCAAGACTTCGAAAATATCGATAAATTGCCACCAATTCATCACCAGAGTAGGAAGCC
 
. : . : . : . : . : . :
JMFS136F01+ AAGATTGCAAGCTGATGATGAGGATTGCCACTTGCAGGCCAAAGCGAAGAAGCTTGCAAG
JMFS114E07+ GCCAAAGCGAAGAAGCTTGCAAG
                      ____________________________________________________________
consensus AAGATTGCAAGCTGATGATGAGGATTGCCACTTGCAGGCCAAAGCGAAGAAGCTTGCAAG
 
. : . : . : . : . : . :
JMFS136F01+ TAATAGCTTGATGCTGCTGAAAAATCTCGAGCTTTAGAATCACCTTCGCCGTATAAACCT
JMFS114E07+ TAATAGCTTGATGCTGCTGAAAAATCTCGAGCTTTAGAATCACCTTCGCCGTATAAACCT
                      ____________________________________________________________
consensus TAATAGCTTGATGCTGCTGAAAAATCTCGAGCTTTAGAATCACCTTCGCCGTATAAACCT
 
. : . : . : . : . : . :
JMFS136F01+ TTGTAACGAGCAAGATCACCGAGATAAATCAGACAACGGTGGCAGGATATTAAACCTTTC
JMFS114E07+ TTGTAACGAGCAAGATCACCGAGATAAATCAGACAACGGTGGCAGGATATTAAACCTTTC
                      ____________________________________________________________
consensus TTGTAACGAGCAAGATCACCGAGATAAATCAGACAACGGTGGCAGGATATTAAACCTTTC
 
. : . : . : . : . : . :
JMFS136F01+ TTCATGTCAGCAGATTTACTTCCATCTTTAGACGATGGAATTTGGTTTTCAGGATCATCA
JMFS114E07+ TTCATGTCAGCAGATTTACTTCCATCTTTAGACGATGGAATTTGGTTTTCAGGATCATCA
                      ____________________________________________________________
consensus TTCATGTCAGCAGATTTACTTCCATCTTTAGACGATGGAATTTGGTTTTCAGGATCATCA
 
. : . : . : . : . : . :
JMFS136F01+ GAGAAATATCCTAGTGGCAGACCATACTTAGCCCTAATTTTCAACATCAAATCATGGTAA
JMFS114E07+ GAGAAATATCCTAGTGGCAGACCATACTTAGCCCTAATTTTCAACATCAAATCATGGTAA
                      ____________________________________________________________
consensus GAGAAATATCCTAGTGGCAGACCATACTTAGCCCTAATTTTCAACATCAAATCATGGTAA
 
. : . : . : . : . : . :
JMFS136F01+ AATCCTGTTGCTTCAGACAGGAATGTCTTAAATTGTGTGCGAATCTTTGTGATTCGATCA
JMFS114E07+ AATCCTGTTGCTTCAGACAGGAATGTCTTAAATTGTGTGCGAATCTTTGTGATTCGATCA
JMFS092C02+ GTGATTCGATCA
                      ____________________________________________________________
consensus AATCCTGTTGCTTCAGACAGGAATGTCTTAAATTGTGTGCGAATCTTTGTGATTCGATCA
 
. : . : . : . : . : . :
JMFS136F01+ GGCCCACCTCGACTAGGACCTTTCCCATTCTGAGATGTGGTTGATCCAGAAGCAGATAAA
JMFS114E07+ GGCCCACCTTGACTAGGACCTTTCCCATTCTGAGATGTGGTTGATCCAGAAGCAGATAAA
JMFS037F07+ GACTAGGACCTTTCCCATTCTGAGATGTGGTTGATCCAGAAGCAGATAAA
JMFS092C02+ GGCCCACCTCGACTAGGACCTTTCCCATTCTGAGATGTGGTTGATCCAGAAGCAGATAAA
                      ____________________________________________________________
consensus GGCCCACCTCGACTAGGACCTTTCCCATTCTGAGATGTGGTTGATCCAGAAGCAGATAAA
 
. : . : . : . : . : . :
JMFS136F01+ GCAGTATTCAAGTGTGCACGTAATTCC
JMFS114E07+ GCAGTATTCAAGTGTGCACGTAATTCCTCAATTCTCCTGTAATGCAACTGCCACAATGCA
JMFS037F07+ GCAGTATTCAAGTGTGCACGTAATTCCTCAATTCTCCTGTAATGCAACTGCCACAATGCA
JMFS092C02+ GCAGTATTCAAGTGTGCACGTAATTCCTCAATTCTCCTGTAATGCAACTGCCACAATGCA
                      ____________________________________________________________
consensus GCAGTATTCAAGTGTGCACGTAATTCCTCAATTCTCCTGTAATGCAACTGCCACAATGCA
 
. : . : . : . : . : . :
JMFS114E07+ TACTCTATTTCATGTTGCTCAGAGAAAGCATGATTCTCAAGGATAATAGCTTCATAATTT
JMFS037F07+ TACTCTATTTCATGTTGCTCAGAGAAAGCATGATTCTCAAGGATAATAGCTTCATAATTT
JMFS092C02+ TACTCTATTTCATGTTGCTCAGAGAAAGCATGATTCTCAAGGATAATAGCTTCATAATTT
                      ____________________________________________________________
consensus TACTCTATTTCATGTTGCTCAGAGAAAGCATGATTCTCAAGGATAATAGCTTCATAATTT
 
. : . : . : . : . : . :
JMFS114E07+ TCACGCATTTGTTGCCATGA
JMFS037F07+ TCACGCATTTGTTGCCATGAATTTGGGTCAGAAGGAATTCTGGCTTGTGCTGCCTTCCTA
JMFS092C02+ TCACGCATTTGTTGCCATGAATTTGGGTCAGAAGGAATTCTGGCTTGTGCTGCCTTCCTA
                      ____________________________________________________________
consensus TCACGCATTTGTTGCCATGAATTTGGGTCAGAAGGAATTCTGGCTTGTGCTGCCTTCCTA
 
. : . : . : . : . : . :
JMFS037F07+ CGCTTATTCTCTAATTCAACATTCTTGTTAAAGAGGCGTTGAACACGCTCACGAGATGAA
JMFS092C02+ CGCTTATTCTCTAATTCAACATTCTTGTTAAAGAGGCGTTGAACACGCTCACGAGATGAA
                      ____________________________________________________________
consensus CGCTTATTCTCTAATTCAACATTCTTGTTAAAGAGGCGTTGAACACGCTCACGAGATGAA
 
. : . : . : . : . : . :
JMFS037F07+ TGATCGACACTGTTATCCATCGGAATGGTCATTATCCATCAAGAGCAGTTTAGCTTCAAA
JMFS092C02+ TGATCGACACTGTTATCCATCGGAATGGTCATTATCCATCAAGAGCAGTTTAGCTTCAAA
                      ____________________________________________________________
consensus TGATCGACACTGTTATCCATCGGAATGGTCATTATCCATCAAGAGCAGTTTAGCTTCAAA
 
. : . : . : . : . : . :
JMFS037F07+ GAACTCCGT-AAACACAAAACCCTTGACCCAAATCAAAGCCAGATCTGCGAAGATCCCGT
JMFS092C02+ GAACTCCGTGAAACACAAAACCCTTGACCCAAATCAAAGCCAGATCTGCGAAGATCCCGT
                      ____________________________________________________________
consensus GAACTCCGTGAAACACAAAACCCTTGACCCAAATCAAAGCCAGATCTGCGAAGATCCCGT
 
. : . : . : . : . : . :
JMFS037F07+ CGTAATAGCCGCT
JMFS092C02+ CGTAATAGCCGCTCTAACCCCACCGATTCCGTCAATTCAGAGAAAATGTATACATGCAAG
                      ____________________________________________________________
consensus CGTAATAGCCGCTCTAACCCCACCGATTCCGTCAATTCAGAGAAAATGTATACATGCAAG
 
. : . : . : . : . : . :
JMFS092C02+ GGTAGGGTTATACAAAGAGAAAACGGAGAGGAAGGCACTAGGGTCTGGAGATATATATAG
                      ____________________________________________________________
consensus GGTAGGGTTATACAAAGAGAAAACGGAGAGGAAGGCACTAGGGTCTGGAGATATATATAG
 
. : . : . : . : . : . :
JMFS092C02+ AGGATGTAATTTCTAAGCCATGATTTGAATGAGAAGGAGAGTTGGAGGAGGAGAAGGAGA
                      ____________________________________________________________
consensus AGGATGTAATTTCTAAGCCATGATTTGAATGAGAAGGAGAGTTGGAGGAGGAGAAGGAGA