Previous Contig 003593:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS075D09Sequence510003593 (14)gb:AF316414_17855381e-13Helianthus annuus resistance gene analog NBS9 (NBS9) gene, partial cds.
JMFS091B01Sequence596003593 (14)gb:AF316412_17855364e-35Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.
JMFS129G09Sequence615003593 (14)gb:AF316412_17855362e-29Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.
JMSF001J13Sequence425018232763003593 (14)gb:AY196151_15889121e-42Solanum tuberosum nematode resistance protein (Gro1-4) gene, Gro1-4-P40 allele,
JMSF004C18Sequence333003593 (14)gb:AF316414_17855383e-20Helianthus annuus resistance gene analog NBS9 (NBS9) gene, partial cds.197008650 (3)
JMSF005C24Sequence427003593 (14)gb:STU9719_17231644e-10Solanum tuberosum mRNA for NL25 protein.
JMSF011N01Sequence426003593 (14)gb:AF316412_17855367e-23Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.769013235 (3)
JMSF018F17Sequence474019068gb:AY196151_15889122e-05Solanum tuberosum nematode resistance protein (Gro1-4) gene, Gro1-4-P40 allele, 756003593 (14)gb:AY196151_15889121e-42Solanum tuberosum nematode resistance protein (Gro1-4) gene, Gro1-4-P40 allele,
JMSF018L01Sequence485003593 (14)gb:AF316412_17855361e-23Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.735012035 (4)gb:AP000492_18202812e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0705D01
JMSF024L20Sequence666003593 (14)gb:PDE416708_16995833e-34Populus deltoides MER locus, genomic DNA, cultivar S9-2.134013235 (3)
JMSF030F23Sequence682003593 (14)gb:AF316412_17855362e-40Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.688012714 (2)gb:AC016661_15381833e-06Arabidopsis thaliana chromosome 3 BAC F11F8 genomic sequence, complete sequence.
JMSF032I24Sequence688003593 (14)gb:AF316412_17855367e-41Helianthus annuus resistance gene analog NBS7 (NBS7) gene, partial cds.709012035 (4)gb:AP000492_18202812e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0705D01
JMSF035A03Sequence261003593 (14)719012035 (4)gb:AP000492_18202816e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0705D01
JMSF046H06Sequence692003593 (14)gb:AY196151_15889122e-42Solanum tuberosum nematode resistance protein (Gro1-4) gene, Gro1-4-P40 allele, 789012714 (2)gb:AP000492_18202812e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0705D01

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF001J13- AGATAGGAAAGTGAAGTCTGATTACAAAGAAGG
                      ____________________________________________________________
consensus AGATAGGAAAGTGAAGTCTGATTACAAAGAAGG
 
. : . : . : . : . : . :
rJMSF018F17- ACGGAATAACAGAAATACAAATAA
rJMSF001J13- ATAACTGCCATCCTTTATACTAATGAGACAGTTATAACGGAATAACAGAAATACAAATAA
                      ____________________________________________________________
consensus ATAACTGCCATCCTTTATACTAATGAGACAGTTATAACGGAATAACAGAAATACAAATAA
 
. : . : . : . : . : . :
rJMSF018F17- GGCTGGAAAAGACAAGATTGCCCTCAGCTTCATTCTTCATCCTTTCTCATTGGACATAGC
rJMSF001J13- GGCTGGAAAAGACAAGATTGCCCTCAGCTTCATTCTTCATCCTTTCTCATTGGACATAGC
                      ____________________________________________________________
consensus GGCTGGAAAAGACAAGATTGCCCTCAGCTTCATTCTTCATCCTTTCTCATTGGACATAGC
 
. : . : . : . : . : . :
rJMSF018F17- AGTATCACATCTATCCTTCATCACGATGCATGA-TTCAATCGAGCATGTATGTCGGCTGC
JMSF004C18+ GGCTAGCGATGCATGATTTCAATCGAGCATGTATGTCGGCAGC
JMFS075D09+ CGATGCATGA-TTCAATCGAGCATGTATGTCGGCTGC
rJMSF001J13- AGTATCACATCTATCCTTCATCACGATGCATGA-TTCAATCGAGCATGTATGTCGGCTGC
JMSF032I24+ CTAGCGATGCATGA-TTCAATCGAGCATGTATGTCGGCAGC
JMSF046H06+ CGATGCATGA-TTCAATCGAGCATGTACGTCGGCAGC
JMSF030F23+ CTAGCGATGCATGA-TTCAATCGAGCATGTACGTCGGCAGC
                      ____________________________________________________________
consensus AGTATCACATCTATCCTTCCTAGCGATGCATGA-TTCAATCGAGCATGTATGTCGGCTGC
 
. : . : . : . : . : . :
rJMSF018F17- AACGTTTTCTGCACATGTTGCTTCGTATTCGTTATAGTCATTCTTCAAATGATACCCTTT
JMSF004C18+ AACATTTTCAGCACATGTTGCTTCGTATTCGTTATAGTCATTCTTCAAATGATACCCTTT
JMFS075D09+ AACGTTTTCTGCACATGTTGCTTCGTATTCGTTATAGTCATTCTTCAAATGATACCCTTT
rJMSF001J13- AACGTTTTCTGCACATGTTGCTTCGTATTCGTTATAGTCATTCTTCAAATGATACCCTTT
JMSF032I24+ AACATNTTCAGCACATGNTGCTTCGTATTCGTTATAGTCATTCTTCAAATGATACCCTTT
JMSF046H06+ AACATTTTCAGCACATGTTGCTTCGTATTCGTTATAGTCATTCTTCAAATGATACCCTTT
JMSF030F23+ AACA-TTTCAGCACATGTTGCTTCGTATTCGTTATAGTCATTCTTCAAATGATACCCTTT
JMSF024L20+ TCGTTATAGTCATTCTTCAAATGATGCCCTTT
                      ____________________________________________________________
consensus AACGTTTTCTGCACATGTTGCTTCGTATTCGTTATAGTCATTCTTCAAATGATACCCTTT
 
. : . : . : . : . : . :
rJMSF018F17- GAGTTGGCCAGCCTTGTTTAAGGCTTCCTTCCATCTTGTTACCTTCT---CATCATCCTT
JMSF004C18+ GAGTTGGCCAGCCTTGTTTAAGGCTTCCTTCCATCTTCTTACCTTCT---CATCATCCTT
JMFS075D09+ GAGTTGGCCAGCCTTGTTTAAGGCTTCCTTCCATCTTGTTACCTTCT---CATCATCCTT
rJMSF001J13- GAGTTGGCCAGCCTTGTTTAAGGCTTCCTTCCATCTTGTTACCTTCT---CATCATCCTT
JMSF032I24+ GAGTTGGCCAGCCTTGTTTAAGGCTTCCTTCCATCTTCTTACCTTCT---CATCATCCTT
JMSF046H06+ GAGTTGGCCAGCCTTGTTTAAGGCTTCCTTCCATCTTCTTACCTTCT---CATCATCCTT
JMFS129G09+ GCTTCCTTCCATCTTCGTACCTTCTCCTCATCATCCTT
JMSF030F23+ GAGTTGGCCAGCCTTGTTTAAGGCTTCCTTCCATCTTCTTACCTTCT---CATCATCCTT
JMSF024L20+ GAGTTCGCCAGCCTTTTTTAAGGCTTTCTTCCATCTTTTTACCTTCT---CCTCCT----
                      ____________________________________________________________
consensus GAGTTGGCCAGCCTTGTTTAAGGCTTCCTTCCATCTTCTTACCTTCT---CATCATCCTT
 
. : . : . : . : . : . :
rJMSF018F17- GCCAATTTTTTCATGCAATTCTTTGAACGAATCTTCAAAACTTCCTTTTTGATTCCGGAC
JMSF004C18+ GCCAATTTTTTCATGCAATTCTTTGAACGAATTTTCATAACTTCCTTTTTGATTCCGGAC
JMFS075D09+ GCCAATTTTTTCATGCAATTCTTTGAACGAATCTTCAAAACTTCCTTTTTGATTCCGGAC
rJMSF001J13- GCCAATTTTTTCATGCAATTCTTTGAACGAATCTTCAAAACTTCCTTTTTGATTCCGGAC
JMSF032I24+ GCCAATTTTTTCATGCAATTCTTTGAACGAATTTTCATAACTTCCTTTTTGATTCCGGAC
JMSF046H06+ GCCAATTTTTTCATGCAATTCTTTGAACGAATTTTCATAACTTCCTTTTTGATTCCGGAC
JMFS129G09+ GCCAATTTTTTCAACCAATTCCTTGAATGAATCCTCAAAACTTCCTTTTTGATTCTGAAC
JMSF030F23+ GCCAATTTTTTCATGCAATTCTTTGAACGAATTTTCATAACTTCCTTTTTGATTCCGGAC
JMSF024L20+ --CAAATCTTTCAACCGATTCTTTGAACGAATTTCCAAAACTTCCTTCCTGTTTCCGGAC
JMFS091B01+ CAATTTTNTCATGCAATTCTTTGAACGAATTTTCATAACTTCCTTTTTGATTCCGGAC
                      ____________________________________________________________
consensus GCCAATTTTTTCATGCAATTCTTTGAACGAATTTTCAAAACTTCCTTTTTGATTCCGGAC
 
. : . : . : . : . : . :
rJMSF018F17- ATCTGTAGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGGTCCTCCAACTTTTCTTG
JMSF004C18+ ATCTGTGGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGCTCCTTCAACTTTTCTTG
JMFS075D09+ ATCTGTAGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGGTCCTCCAACTTTTCTTG
rJMSF001J13- ATCTGTAGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGGTCCTCCAACTTTTCTTG
JMSF032I24+ ATCTGTGGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGCTCCTTCAACTTTTCTTG
JMSF046H06+ ATCTGTGGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGCTCCTTCAACTTTTCTTG
JMFS129G09+ ATCTGAAGGCTCCACATAGCATAAAATTGGCACCACCATTTGCTCTTTCAAATTTTCTTG
JMSF030F23+ ATCTGTGGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGCTCCTTCAACTTTTCTTG
JMSF024L20+ ATCTGAAGGTTCTACGTGGTAGAAAATTGGCACCACAATTTGCTC------CTTTTTTTG
JMFS091B01+ ATCTGTGGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGCTCCTTCAACTTTTCTTG
                      ____________________________________________________________
consensus ATCTGTAGGCTCCACGTGGTAGAAAATTGGCACCACAATTTGCTCCTTCAACTTTTCTTG
 
. : . : . : . : . : . :
rJMSF018F17- GCATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGCCTTTGGA
JMSF004C18+ GCATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGC
JMFS075D09+ GCATTCCATGACTGTTGCAAG
rJMSF001J13- GCATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGCCTTTGGA
JMSF032I24+ GCATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGCCTTTGGA
JMSF046H06+ GCATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGCCTTTGGA
JMFS129G09+ GCGTTCCATGATTGTTGCAAGTTCTTCCAAACACCATTTTGACAATGCATAACCTTTGGA
JMSF030F23+ GCATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGCCTTTGGA
JMSF011N01+ CATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGAAGAAGCATAGCCTTTGGA
JMSF024L20+ GCATTCCATGACTGTTGCAAGTCCTTCCAAACACCATTTTGAAGAAGCATAGCCTTTGGA
JMSF018L01+ TTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGCCTTTGGA
JMFS091B01+ GCATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGCCTTTGGA
                      ____________________________________________________________
consensus GCATTCCATGACTGTTGCAAGTTCTTCCAAACACCATTTTGACGAAGCATAGCCTTTGGA
 
. : . : . : . : . : . :
rJMSF018F17- GAAGACTGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
rJMSF001J13- GAAGACTGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
JMSF032I24+ GAAGACTGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
JMSF046H06+ GAAGACTGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
JMFS129G09+ GAAGATTGCGATCAAGAACTTTGATTCTTGAATAGCTTTTAGTAGGCTCGGGGAGATGCA
JMSF030F23+ GAAGACTGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
JMSF011N01+ GAAGACTGGGATAAAAAACTTTGATTCTCGAATAGCATTTGGTAGGCTCAGAGAGATGCA
JMSF024L20+ GAAGACTGGGATAAAAAACTTTGATTCTCGAATAGCATTTGGTAGGCTCAGAGAGATGCA
JMSF018L01+ GAAGACTGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
JMSF005C24+ TGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
JMFS091B01+ GAAGACTGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
                      ____________________________________________________________
consensus GAAGACTGCGATAAAAAACTTTGATTCCCGAATAGCATTTGGTAGGCTCTGAGAGATGCA
 
. : . : . : . : . : . :
rJMSF018F17- GTCTCCTTTCTCCAGTCGATCGTCATCTTTGAAAGTGCGAATCCCTTTACGTTCTAACGA
rJMSF001J13- GTCTCCTTTCTCCAGTCGATCGTCATCTTTGAAAGTGCGAATCCCTTTACGTTCTAACGA
JMSF032I24+ GTCCCCTTTCTCCAGTCGATCGTCATCTTTGAAAGTGTGAATCCCTCTACGTTCTAACGA
JMSF046H06+ GTCCCCTTTCTCCAGTCGATCGTCATCTTTGAAAGTGTGAATCCCTCTACGTTCTAACGA
JMFS129G09+ GTCTCCTTTCTCAAGTCGATCGTCATCTTTGAAAGTGCGAATTCCTTTACGCTCTAAGGA
JMSF030F23+ GTCCCCTTTCTCCAGTCGATCGTCATCTTTGAAAGTGTGAATCCCTCTACGTTCTAACGA
JMSF011N01+ GTCTCCTTTCTCCAGTCGATTGTCATCTTTGAAAGTGCGAATCCCTCTACATTCTAACGA
JMSF024L20+ GTCTCCTTTCTCCAGTCGATTGTCATCTTTGAAAGTGCGAATCCCTCTACATTCTAACGA
JMSF018L01+ GTCCCCTTTCTCCAGTCGATCGTCATCTTTGAAAGTGTGAATCCCTCTACGTTCTAACGA
JMSF005C24+ GTCCCCTTTCTCCAGTCGATCGTCATC-TTGAAAGTGTGAATCCCTCTACGTTCTAACGA
JMFS091B01+ GTCCCCTTTCTCCAGTCGATCGTCATCTTTGAAAGTGTGAATCCCTCTACGTTCTAACGA
                      ____________________________________________________________
consensus GTCTCCTTTCTCCAGTCGATCGTCATCTTTGAAAGTGTGAATCCCTCTACGTTCTAACGA
 
. : . : . : . : . : . :
rJMSF018F17- TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
rJMSF001J13- TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
JMSF032I24+ TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
JMSF046H06+ TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
JMFS129G09+ ACCATAAAGGTAATCTATAAAAGTCTCACAAGTATCTGAACCTCTAAAACTCAAAAAAAA
JMSF030F23+ TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
JMSF011N01+ CTCATAAAGGACATCTATAAAAGTTTTACGAGTATCTGGACCTCTAAAACTC-AAGAAAA
JMSF024L20+ CTCATAAAGGACATCTATAAAAGTTTTACGAGTATCTGGACCTCTAAAACTC-AAGAAAA
JMSF018L01+ TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
JMSF005C24+ TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
JMSF035A03+ AACTC-AAGAAAA
JMFS091B01+ TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
                      ____________________________________________________________
consensus TTCAAAAAGGAAATCTATAAAAGTTTTACGAACATCTGGACCTCGAAAACTC-AAGAAAA
 
. : . : . : . : . : . :
rJMSF018F17- CATCATACGTCCATCCCTGAGGGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
rJMSF001J13- CATCATACGTCCATCCCTGAGGGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
JMSF032I24+ CATCATACGTCCATCCCTGAGTGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
JMSF046H06+ CATCATACGTCCATCCCTGAGTGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
JMFS129G09+ CATCATAAGTCCATCTCTGAGTTGATTGTGAAGCAGTAGCAGAAGA
JMSF030F23+ CATCATACGTCCATCCCTGAGTGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
JMSF011N01+ CATCATAGGTCCATCCCTGAGTGGATGGCGAAGCAGTAGCAGAAGAAGAGGTAGAAGCCA
JMSF024L20+ CATCATAGGCCCATCCCTGAGTGGATGGCGAAGCAGTAGCAGAAGAAGAGGTAGAAGCCA
JMSF018L01+ CATCATACGTCCATCCCTGAGTGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
JMSF005C24+ CATCATACGTCCATCCCTGAGTGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
JMSF035A03+ CATCATACGTCCATCCCTGAGTGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
JMFS091B01+ CATCATACGTCCATCCCTGAGTGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
                      ____________________________________________________________
consensus CATCATACGTCCATCCCTGAGTGGATGGCGAAGCAGTAACAGAAGAAGAGGTAGAAGCCA
 
. : . : . : . : . : . :
rJMSF018F17- T
rJMSF001J13- TATATTGATATGATA
JMSF032I24+ TCTA-TGAAGCCATATATTGATATGGCCGGAATTCAATCGGCCGGATTCCTCTAACACAA
JMSF046H06+ TCTA-TGAAGCCATATATTGATATGGCCGGAATTCAATCGGCCGGATTCCTCTAACACAA
JMSF030F23+ TCTA-TGAAGCCATATATTGATATGGCCGGAATTCAATCGGCCGGATTCCTCTAACACAA
JMSF011N01+ TCTA-TCAAGCCATATATTGATATGACCGGAATTCGATCGGCCGGATTCCTCTAACACAT
JMSF024L20+ TCTA-TCAAGCCATATATTGATATGACCGGAATTCGATCGGCCGGATTCCTCTAACACAT
JMSF018L01+ TCTA-TGAAGCCATATATTGATATGGCCGGAATTCAATCGGCCGGATTCCTCTAACACAA
JMSF005C24+ TCTA-TGAAGCCATATATTGATATGGCCGGAATTCAATCGGCCGGATTCCTCTAACACAA
JMSF035A03+ T
JMFS091B01+ TCTA-TGAAGCCATATATTGATATGGCCGGAATTCAATCGGCCGGATTCCTCTAACACAA
                      ____________________________________________________________
consensus TCTA-TGAAGCCATATATTGATATGGCCGGAATTCAATCGGCCGGATTCCTCTAACACAA
 
. : . : . : . : . : . :
JMSF032I24+ GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGAT
JMSF046H06+ GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGAT
JMSF030F23+ GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGAT
JMSF011N01+ GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGATGAACAAA
JMSF024L20+ GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGATGAACAAAC
JMSF018L01+ GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGATGAACAAACAAAAC
JMSF005C24+ GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGATGAACAAACAAAAC
JMFS091B01+ GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGATGAACAAACAAAAC
                      ____________________________________________________________
consensus GCAGGGAAGTAATTAGAAGGGAGATTGAAAAGCATATGAAATATGATGAACAAACAAAAC
 
. : . : . : . : . : . :
JMSF018L01+ TACAATAG
JMSF005C24+ TACAATAG
JMFS091B01+ TACAATAGGCGTGACTTTGTACAAGTCGTCTCAGAAAATTTCATCGGATTCTTCAGGTAG
                      ____________________________________________________________
consensus TACAATAGGCGTGACTTTGTACAAGTCGTCTCAGAAAATTTCATCGGATTCTTCAGGTAG