Previous Contig 003592:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS091A05Sequence626003592 (2)gb:AP005193_18491923e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P049
JMFS127B01Sequence626003592 (2)gb:AE008692_2406200.042Zymomonas mobilis subsp. mobilis ZM4, complete genome.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS127B01+ AAAACCTGAGGACAGAGGTCAGAGAGATGCTCAACA
                      ____________________________________________________________
consensus AAAACCTGAGGACAGAGGTCAGAGAGATGCTCAACA
 
. : . : . : . : . : . :
JMFS127B01+ TCTGTTATACTGGCTCGAAATCCAAATTTACCAAGTTGATCAAGTGCTTGCTTCAGAGAA
                      ____________________________________________________________
consensus TCTGTTATACTGGCTCGAAATCCAAATTTACCAAGTTGATCAAGTGCTTGCTTCAGAGAA
 
. : . : . : . : . : . :
JMFS127B01+ CACAAGGTAACTTTTCCATGCTGAAGTTGAATAACAGCAGAATATATATTTATGAAAGAA
JMFS091A05+ CAGCAGAATATATATTTATGAAAGAA
                      ____________________________________________________________
consensus CACAAGGTAACTTTTCCATGCTGAAGTTGAATAACAGCAGAATATATATTTATGAAAGAA
 
. : . : . : . : . : . :
JMFS127B01+ AATAATTTCATTTTACTTTTCAACCATGATGGGCACAAGCACAAATTGCTTTTTGTTGAC
JMFS091A05+ AATAATTTCATTTTACTTTTCAACCATGATGGGCACAAGCACAAATTGCTTTTTGTTGAC
                      ____________________________________________________________
consensus AATAATTTCATTTTACTTTTCAACCATGATGGGCACAAGCACAAATTGCTTTTTGTTGAC
 
. : . : . : . : . : . :
JMFS127B01+ CGCGGGTTCATCTCAGTGTTCTGTCTGCGAGCTTCATTACATATGCAGTTCCCTGAACTT
JMFS091A05+ CGCGGATTCATCTCAGTGTTCTGTCTGCGAGCTTCATTACATATGCAGTTCCCTGAACTT
                      ____________________________________________________________
consensus CGCGGGTTCATCTCAGTGTTCTGTCTGCGAGCTTCATTACATATGCAGTTCCCTGAACTT
 
. : . : . : . : . : . :
JMFS127B01+ GGATCAAATAAGCAATTAACTGAATCTAAAACCATGACAAATTTAGATGCCTGTTCGTCT
JMFS091A05+ GGATCAAATAAGCAATTAACTGAATCTAAAACCATGACAAATTTAGATGCCTGTTCGTCT
                      ____________________________________________________________
consensus GGATCAAATAAGCAATTAACTGAATCTAAAACCATGACAAATTTAGATGCCTGTTCGTCT
 
. : . : . : . : . : . :
JMFS127B01+ ATACTACTGCTAGGTGACTGCAGTATGTCAAATATGAGCTCATCTGTAGGTTGTTCTGTC
JMFS091A05+ ATACTACTGCTAGGTGACTGCAGTATGTCAAATATGAGCTCATCTGTAGGTTGTTCTGTC
                      ____________________________________________________________
consensus ATACTACTGCTAGGTGACTGCAGTATGTCAAATATGAGCTCATCTGTAGGTTGTTCTGTC
 
. : . : . : . : . : . :
JMFS127B01+ TTATTAGATACAGATTTTAACTTGCGTTTTCTCTGTGAAGTACCACTGGAAGAAACATTG
JMFS091A05+ TTATTAGATACAGATTTTAACTTGCGTTTTCTCTGTGAAGTACCACTGGAAGAAACATTG
                      ____________________________________________________________
consensus TTATTAGATACAGATTTTAACTTGCGTTTTCTCTGTGAAGTACCACTGGAAGAAACATTG
 
. : . : . : . : . : . :
JMFS127B01+ ACATTTTGTGCTTGTCTATTTTCAGAATTAACTGACTCTAACTCAATATCGTTTTGAGTT
JMFS091A05+ ACATTTTGTGCTTGTCTATTTTCAGAATTAACTGACTCTAACTCAATATCGTTTTGAGTT
                      ____________________________________________________________
consensus ACATTTTGTGCTTGTCTATTTTCAGAATTAACTGACTCTAACTCAATATCGTTTTGAGTT
 
. : . : . : . : . : . :
JMFS127B01+ TTATTGCTAATTGTGCTGCGCAAAACTGATAGGTCTTCCACCACATCACGCCACGTTGAC
JMFS091A05+ TTATTGCTAATTGTGCTGCGCAAAACTGATAGGTCTTCCACCACATCACGCCACGTTGAC
                      ____________________________________________________________
consensus TTATTGCTAATTGTGCTGCGCAAAACTGATAGGTCTTCCACCACATCACGCCACGTTGAC
 
. : . : . : . : . : . :
JMFS127B01+ TCAGATTGTTTTGAAGTTGCAAATCTTGTCATAGCTGGGGATGTAGCAGA
JMFS091A05+ TCAGATTGTTTTGAAGTTGCAAATCTTGTCATAGCTGGGGATGTAGCAGATTGCTCAGTC
                      ____________________________________________________________
consensus TCAGATTGTTTTGAAGTTGCAAATCTTGTCATAGCTGGGGATGTAGCAGATTGCTCAGTC
 
. : . : . : . : . : . :
JMFS091A05+ TGCTGTCTATCCTTCTTTGCAAAAGGAACAAGAACCAAAAAATCACCATCACCAATTGAA
                      ____________________________________________________________
consensus TGCTGTCTATCCTTCTTTGCAAAAGGAACAAGAACCAAAAAATCACCATCACCAATTGAA
 
. : . : . : . : . : . :
JMFS091A05+ TAGCTGCCTAGCTTATTCTCTACTGCCATTTTCATCCCCTAATCCAAACAATGCAAGGGA
                      ____________________________________________________________
consensus TAGCTGCCTAGCTTATTCTCTACTGCCATTTTCATCCCCTAATCCAAACAATGCAAGGGA