Previous Contig 003586:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001B01Sequence683003586 (5)gb:SAC249448_17046707e-25Solanum acaule Rx2.ac15 gene for NBS-LRR protein, exons 1-3.
JMFF013M15Sequence607003586 (5)gb:AY830138_16293398e-16Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.700003586 (5)gb:SAC249448_17046707e-26Solanum acaule Rx2.ac15 gene for NBS-LRR protein, exons 1-3.
JMFS089C07Sequence621003586 (5)gb:AY830138_16293391e-17Ipomoea batatas cultivar Beauregard clone BAC117E14, complete sequence.
JMSF046K06Sequence674003586 (5)gb:AB125881_15282233e-32Ipomoea batatas SRF2 mRNA for NBS-LRR protein, partial cds.853024218gb:AX076881_14606693e-25Sequence 2 from Patent WO0107635.>gb:AX076883_1460670 Sequence 4 from Patent WO0

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF001B01- TTTCTGATAGTCT
rJMFF013M15- GATAGTCT
                      ____________________________________________________________
consensus TTTCTGATAGTCT
 
. : . : . : . : . : . :
rJMFF001B01- ATCTGAAACATTAATCTTCATTGCTATATAAATTTTCAACAGATATCATGGATAACCTTG
rJMFF013M15- ATCTGAAAC-TTAATCTTCATTGCTATATAAATTTTCAACAGATATCATGGATAACCTTG
                      ____________________________________________________________
consensus ATCTGAAACATTAATCTTCATTGCTATATAAATTTTCAACAGATATCATGGATAACCTTG
 
. : . : . : . : . : . :
rJMFF001B01- ACGGCATCCAAAGAAGAGCCTCCCTTAGATTGTGTTTCTGCATCAAAAGAAGAGCCTCCC
rJMFF013M15- ACGGCATCCAAAGAAGAGCCTCCCTTAGATTGTGTTTCTGCATCAAAAGAAGAGCCTCCC
                      ____________________________________________________________
consensus ACGGCATCCAAAGAAGAGCCTCCCTTAGATTGTGTTTCTGCATCAAAAGAAGAGCCTCCC
 
. : . : . : . : . : . :
rJMFF001B01- TTAGAGCTTCTGCCTCCATTCGCAGTGTGGACTCCTCTCGAAGGAACACTTTTAGCAAGA
rJMFF013M15- TTAGAGCTTCTGCCTCCATTCGCAGTGTGGACTCCTCTCGAAGGAACACTTTTAGCAAGA
                      ____________________________________________________________
consensus TTAGAGCTTCTGCCTCCATTCGCAGTGTGGACTCCTCTCGAAGGAACACTTTTAGCAAGA
 
. : . : . : . : . : . :
rJMFF001B01- TCAATTGCGACATCAACTTTAATCTAACGCAGCCTTGCCTCTGTTGCTCATACGTTGCTC
rJMFF013M15- TCAATTGCGACATCAACTTTAATCTAACGCAGCCTTGCCTCTGTTGCTCATACGTTGCTC
                      ____________________________________________________________
consensus TCAATTGCGACATCAACTTTAATCTAACGCAGCCTTGCCTCTGTTGCTCATACGTTGCTC
 
. : . : . : . : . : . :
rJMFF001B01- AAAAGTGTAAATAAGAATTCTTGAGCATTGTTCACCAATATCTGTACTAGCAAGATAGCT
rJMFF013M15- AAAAGTGTAAATAAGAATTCTTGAGCATTGTTCACCAATATCTGTACTAGCAAGATAGCT
                      ____________________________________________________________
consensus AAAAGTGTAAATAAGAATTCTTGAGCATTGTTCACCAATATCTGTACTAGCAAGATAGCT
 
. : . : . : . : . : . :
rJMFF001B01- CATTTCTTTCTCAAGCTTTTCCAATTCTTCAACTTTGCTGAATTGGGATACAAGTCCAGC
rJMFF013M15- CATTTCTTTCTCAAGCTTTTCCAATTCTTCAACTTTGCTGAATTGGGATACAAGTCCAGC
                      ____________________________________________________________
consensus CATTTCTTTCTCAAGCTTTTCCAATTCTTCAACTTTGCTGAATTGGGATACAAGTCCAGC
 
. : . : . : . : . : . :
rJMFF001B01- AGCTACAACAATTGCCAGGGGAAGCCCCCCACACTTGCCAACAATATTCCTTCCAATTGT
rJMFF013M15- AGCTACAACAATTGCCAGGGGAAGCCCCCCACACTTGCCAACAATATTCCTTCCAATTGT
                      ____________________________________________________________
consensus AGCTACAACAATTGCCAGGGGAAGCCCCCCACACTTGCCAACAATATTCCTTCCAATTGT
 
. : . : . : . : . : . :
rJMFF001B01- GTTGAACTTAGAGTGCAAGGGCTGTTTCAAGAAAATATGACTGCAAAATAGATCCCAACT
rJMFF013M15- GTTGAACTTAGAGTGCAAGGGCTGTTTCAAGAAAATATGACTGCAAAATAGATCCCAACT
                      ____________________________________________________________
consensus GTTGAACTTAGAGTGCAAGGGCTGTTTCAAGAAAATATGACTGCAAAATAGATCCCAACT
 
. : . : . : . : . : . :
rJMFF001B01- TTTATCAGAATTGAGAAAATGCAAGTCATGAAGAAGATTGCTGGCACCTGATGTAGTGTA
rJMFF013M15- TTTATCAGAATTGAGAAAATGCAAGTCATGAAGAAGATTGCTGGCACCTGATGTAGTGTA
JMSF046K06+ ATCAGAATTGAGAAAATGCAAGTCATGAAGAAGATTGCTGGCACCTGATGTAGTGTA
                      ____________________________________________________________
consensus TTTATCAGAATTGAGAAAATGCAAGTCATGAAGAAGATTGCTGGCACCTGATGTAGTGTA
 
. : . : . : . : . : . :
rJMFF001B01- GTCTGCAATCTCTCTTAGCCGAGAGGTCACCAATACTACACTTCCATAACTTTTAGGAAA
rJMFF013M15- GTCTGCAATCTCTCTTAGCCGAGAGGTCACCAATACTACACTTCCATAACTTTTAGGAAA
JMSF046K06+ GTCTGCAATCTCTCTTAGCCGAGAGGTCACCAATACTACACTTCCATAACTTTTAGGAAA
                      ____________________________________________________________
consensus GTCTGCAATCTCTCTTAGCCGAGAGGTCACCAATACTACACTTCCATAACTTTTAGGAAA
 
. : . : . : . : . : . :
rJMFF001B01- ACATCTGGTGAGATAATCCCAGACATTGGTTTCCCATACGTCATCCACCACAATCAGATA
rJMFF013M15- ACATCTGGTGAGATAATCCCAGACATTGGTTTCCCATACGTCATCCACCACAATCAGATA
JMSF046K06+ ACATCTGGTGAGATAATCCCAGACATTGGTTTCCCATACGTCATCCACCACAATCAGATA
                      ____________________________________________________________
consensus ACATCTGGTGAGATAATCCCAGACATTGGTTTCCCATACGTCATCCACCACAATCAGATA
 
. : . : . : . : . : . :
rJMFF001B01- CCTCATACCC
rJMFF013M15- CCTCATACCCATCAAACGCTGTCGTAGC
JMSF046K06+ CCTCATACCCATCAAACGCTGTCGTAGCTTGTGTGCTAGTTCATCTAGTGTGCTTCCCTC
                      ____________________________________________________________
consensus CCTCATACCCATCAAACGCTGTCGTAGCTTGTGTGCTAGTTCATCTAGTGTGCTTCCCTC
 
. : . : . : . : . : . :
JMSF046K06+ GGTATTCATTCCTCTCTGAATGGACCAAAGAAGGCTGCAGAGAATTTGTCTCATGTTAAC
                      ____________________________________________________________
consensus GGTATTCATTCCTCTCTGAATGGACCAAAGAAGGCTGCAGAGAATTTGTCTCATGTTAAC
 
. : . : . : . : . : . :
JMSF046K06+ TTCTTGAGAGACAGTAGTCCATGCACGAAGGTCAAAGTAGGATAGCACTGATGGATCTTC
                      ____________________________________________________________
consensus TTCTTGAGAGACAGTAGTCCATGCACGAAGGTCAAAGTAGGATAGCACTGATGGATCTTC
 
. : . : . : . : . : . :
JMSF046K06+ GTAAACGCTTTTGGCTAAAGTAGTTTTACCGATCCCGCCCATCCCAAGAATGGAAATGAC
JMFF013M15+ ATGGAAATGAC
JMFS089C07+ CCATCCCAAGAATGGAAATGAC
                      ____________________________________________________________
consensus GTAAACGCTTTTGGCTAAAGTAGTTTTACCGATCCCGCCCATCCCAAGAATGGAAATGAC
 
. : . : . : . : . : . :
JMSF046K06+ TTTCCCTTCTTTAGATGGTTGATGAATGAGCTGATTCTTTATTGTTTTTAATTCTCTTCT
JMFF013M15+ TTTCCCTTCTTTAGATGGTTGATGAATGAGCTGATTCTTTATTGTTTTTAATTCTCTTCT
JMFS089C07+ TTTCCCTTCTTTAGATGGTTGATGAATGAGCTGATTCTTTATTGTTTTTAATTCTCTTCT
                      ____________________________________________________________
consensus TTTCCCTTCTTTAGATGGTTGATGAATGAGCTGATTCTTTATTGTTTTTAATTCTCTTCT
 
. : . : . : . : . : . :
JMSF046K06+ ACGCCCAATCATTCGGTCCTCAATCTTTGAGATCCACTCATGTGAAGATAACGGAAGGGC
JMFF013M15+ ACGCCCAATCATTCGGTCCTCAATCTTTGAGATCCACTCATGTGAAGATAACGGAAGGGC
JMFS089C07+ ACGCCCAATCATTCGGTCCTCAATCTTTGAGATCCACTCATGTGAAGATAACGGAAGGGC
                      ____________________________________________________________
consensus ACGCCCAATCATTCGGTCCTCAATCTTTGAGATCCACTCATGTGAAGATAACGGAAGGGC
 
. : . : . : . : . : . :
JMSF046K06+ TTGTACCTTTGTCAAATCTTGGACAGCAGAATCATTGTATTCTCTTTTAATTCCGTTAAC
JMFF013M15+ TTGTACCTTTGTCAAATCTTGGACAGCAGAATCATTGTATTCTCTTTTAATTCCGTTAAC
JMFS089C07+ TTGTACCTTTGTCAAATCTTGGACAGCAGAATCATTGTATTCTCTTTTAATTCCGTTAAC
                      ____________________________________________________________
consensus TTGTACCTTTGTCAAATCTTGGACAGCAGAATCATTGTATTCTCTTTTAATTCCGTTAAC
 
. : . : . : . : . : . :
JMSF046K06+ GAAGTTTTGAGTTTTTTTCAGCTACTTGTCGTAGGTTCTGAAAAAGTATCATCTCTGCAT
JMFF013M15+ GAAGTTTTGAG-TTTTTTCAGCTACTTGTCGTAGGTTCTGAAAAAGTATCATCTCTGCAT
JMFS089C07+ GAAGTTTTGAG-TTTTTTCAGCTACTTGTCGTAGGTTCTGAAAAAGTATCATCTCTGCAT
                      ____________________________________________________________
consensus GAAGTTTTGAG-TTTTTTCAGCTACTTGTCGTAGGTTCTGAAAAAGTATCATCTCTGCAT
 
. : . : . : . : . : . :
JMSF046K06+ CTTCACCTAGTACTTGT
JMFF013M15+ CTTCACCTAGTACTTGTTGTAGGTTCTGAAAGAGTGTCATCTCCTTATCTGCCGCCTCCA
JMFS089C07+ CTTCACCTAGTACTTGTTGTAGGTTCTGAAAGAGTGTCATCTCCTTATCTGCCGCCTCCA
                      ____________________________________________________________
consensus CTTCACCTAGTACTTGTTGTAGGTTCTGAAAGAGTGTCATCTCCTTATCTGCCGCCTCCA
 
. : . : . : . : . : . :
JMFF013M15+ TATATATCTTTGCCAGATTTGATTCAACTTCATCTTCTGCTAAAAAGGCGAAGTCTCTGA
JMFS089C07+ TATATATCTTTGCCAGATTTGATTCAACTTCATCTTCTGCTAAAAAGGCGAAGTCTCTGA
                      ____________________________________________________________
consensus TATATATCTTTGCCAGATTTGATTCAACTTCATCTTCTGCTAAAAAGGCGAAGTCTCTGA
 
. : . : . : . : . : . :
JMFF013M15+ TTTTGGCTTCCAAATCTTTGATTGCAGCATCATCATTTCCGGGTTTTTTCTGGAATTCCT
JMFS089C07+ TTTTGGCTTCCAAATCTTTGATTGCAGCATCATCATTTCCGGGTTTTTTCTGGAATTCCT
                      ____________________________________________________________
consensus TTTTGGCTTCCAAATCTTTGATTGCAGCATCATCATTTCCGGGTTTTTTCTGGAATTCCT
 
. : . : . : . : . : . :
JMFF013M15+ CAAGAAAGGTGAGCAAGAAACCAAGATTATGGTGGAGAGAACTAACCAAATGTGCTGTAT
JMFS089C07+ CAAGAAAGGTGAGCAAGAAACCAAGATTATGGTGGAGAGAACTAACCAAATGTGCTGTAT
                      ____________________________________________________________
consensus CAAGAAAGGTGAGCAAGAAACCAAGATTATGGTGGAGAGAACTAACCAAATGTGCTGTAT
 
. : . : . : . : . : . :
JMFF013M15+ CTTCAGCAAGAATCACAGGTGCTCTGCAGGGTTGTAAGAACTCAAAGTGGATTGTATTCA
JMFS089C07+ CTTCAGCAAGAATCACAGGTGCTCTGCAGGGTTGTAAGAACTCAAAGTGGATTGTATTCA
                      ____________________________________________________________
consensus CTTCAGCAAGAATCACAGGTGCTCTGCAGGGTTGTAAGAACTCAAAGTGGATTGTATTCA
 
. : . : . : . : . : . :
JMFF013M15+ TCAGAGAAGTTAGAGGAACACAAGCCATTTCTCTCTCTCTCTGTATTTGCTTCAGAC
JMFS089C07+ TCAGAGAAGTTAGAGGAACACAAGCCATTTCTCTCTCTCTCTGTATTTGCTTCAGACGGA
                      ____________________________________________________________
consensus TCAGAGAAGTTAGAGGAACACAAGCCATTTCTCTCTCTCTCTGTATTTGCTTCAGACGGA