Previous Contig 003574:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009J02Sequence538003574 (3)gb:AF053311_17644372e-49Zantedeschia aethiopica glutathione peroxidase (gpx) mRNA, nuclear gene encoding151020852
JMFN020D01Sequence665003574 (3)sp|P52032|GPX1_ARATH7e-78Phospholipid hydroperoxide glutathione peroxidase, chloroplast precursor (EC 1.1
JMFS087B03Sequence624003574 (3)gb:AF053311_17644372e-64Zantedeschia aethiopica glutathione peroxidase (gpx) mRNA, nuclear gene encoding

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN020D01+ AGGTCATGCAGCCAAGAGCTTC
                      ____________________________________________________________
consensus AGGTCATGCAGCCAAGAGCTTC
 
. : . : . : . : . : . :
JMFN020D01+ TGAATATCCTTCTCTATTTGGAAAGGAGAAGTTGTTGGCTGATATCGTTCTACAACTTTT
                      ____________________________________________________________
consensus TGAATATCCTTCTCTATTTGGAAAGGAGAAGTTGTTGGCTGATATCGTTCTACAACTTTT
 
. : . : . : . : . : . :
JMFN020D01+ CCATTTTGTCCACAAGAACTTTCTCAAAGTTCCATTTGATCAGATCACCCAAGAACCCTC
JMFS087B03+ TGATCAGATCACCCAAGAACCCTC
                      ____________________________________________________________
consensus CCATTTTGTCCACAAGAACTTTCTCAAAGTTCCATTTGATCAGATCACCCAAGAACCCTC
 
. : . : . : . : . : . :
JMFN020D01+ CCGCATTTGATTTTAGGAATTGGTAAACCGGGGCTGTGTTTGGCCCATTCACATCAACCT
JMFF009J02+ ACCT
JMFS087B03+ CCGCATTTGATNTTAGGAATTGGTAAACCGGGGCTGTGTTTGGCCCATTCACATCAACCT
                      ____________________________________________________________
consensus CCGCATTTGATTTTAGGAATTGGTAAACCGGGGCTGTGTTTGGCCCATTCACATCAACCT
 
. : . : . : . : . : . :
JMFN020D01+ TGTCAAAAATTGGAAATTCAGCTTTAAATCGTGTGCAAGCAAACTGCTTGATCTGCTCAT
JMFF009J02+ NGTCAAAAATTGGAAATTCAGCTTTAAATCGTGTGCAAGCAAACTGCTTGATCTGCTCAT
JMFS087B03+ TGTCAAAAATTGGAAATTCAGCTTTAAATCGTGTGCAAGCAAACTGCTTGATCTGCTCAT
                      ____________________________________________________________
consensus TGTCAAAAATTGGAAATTCAGCTTTAAATCGTGTGCAAGCAAACTGCTTGATCTGCTCAT
 
. : . : . : . : . : . :
JMFN020D01+ TGGATCCCGGCTCTTGCCCTCCAAACTGATTACATGGAAAAGCAAGAATTTCAAATCCTT
JMFF009J02+ TGGATCCCGGCTCTTGCCCTCCAAACTGATTACATGGAAAAGCAAGAATTTCAAATCCTT
JMFS087B03+ TGGATCCCGGCTCTTGCCCTCCAAACTGATTACATGGAAAAGCAAGAATTTCAAATCCTT
                      ____________________________________________________________
consensus TGGATCCCGGCTCTTGCCCTCCAAACTGATTACATGGAAAAGCAAGAATTTCAAATCCTT
 
. : . : . : . : . : . :
JMFN020D01+ GGGTTTTGTACTTTTCATATATATGAGAGAGTTCTGAATAGTTAGATGTTGTCAAACCAC
JMFF009J02+ GGGTTTTGTACTTTTCATATATATGAGAGAGTTCTGAATAGTTAGATGTTGTCAAACCAC
JMFS087B03+ GGGTTTTGTACTTTTCATATATATGAGAGAGTTCTGAATAGTTAGATGTTGTCAAACCAC
                      ____________________________________________________________
consensus GGGTTTTGTACTTTTCATATATATGAGAGAGTTCTGAATAGTTAGATGTTGTCAAACCAC
 
. : . : . : . : . : . :
JMFN020D01+ ATCTGGAAGCAACATTAACAATCAACAGAACCTTTCCCTTAAATTTACTGAGTGAAACAT
JMFF009J02+ ATCTGGAAGCAACATTAACAATCAACAGAACCTTTCCCTTAAATTTACTGAGTGAAACAT
JMFS087B03+ ATCTGGAAGCAACATTAACAATCAACAGAACCTTTCCCTTAAATTTACTGAGTGAAACAT
                      ____________________________________________________________
consensus ATCTGGAAGCAACATTAACAATCAACAGAACCTTTCCCTTAAATTTACTGAGTGAAACAT
 
. : . : . : . : . : . :
JMFN020D01+ CTTTCCCATCAATGTCCTTGACAGTGAAATCATGAATAGACTTGTCGGTGGCAGCTCGGG
JMFF009J02+ CTTTCCCATCAATGTCCTTGACAGTGAAATCATGAATAGACTTGTCGGTGGCAGCTCGGG
JMFS087B03+ CTTTCCCATCAATGTCCTTGACAGTGAAATCATGAATAGACTTGTCGGTGGCAGCTCGGG
                      ____________________________________________________________
consensus CTTTCCCATCAATGTCCTTGACAGTGAAATCATGAATAGACTTGTCGGTGGCAGCTCGGG
 
. : . : . : . : . : . :
JMFN020D01+ AG--TATCTTGGCGGAGAGTTTGGAGTTGAGAAGGGGCGCGGAGAGCTTGGAGGATGGGA
JMFF009J02+ AGTATATCTTGGCGGAGAGTTTGGAGTTGAGAAGGGGCGCGGAGAGCTTGGAGGATGGGA
JMFS087B03+ AGTATATCTTGGCGGAGAGTTTGGAGTTGAGAAGGGGCGCGGAGAGCTTGGAGGATGGGA
                      ____________________________________________________________
consensus AGTATATCTTGGCGGAGAGTTTGGAGTTGAGAAGGGGCGCGGAGAGCTTGGAGGATGGGA
 
. : . : . : . : . : . :
JMFN020D01+ GAGAAAGGCCAATATGGGAAAACGACGATTTTGAAGAAAGAAACGCCATGGAAGGAGGTA
JMFF009J02+ GAGAAAGGCCAATATGGGAAAACGACGATTTTGAAGAAAGAAACGCCATGGAAGGAGGTA
JMFS087B03+ GAGAAAGGCCAATATGGGAAAACGACGATTTTGAAGAAAGAAACGCCATGGAAGGAGGTA
                      ____________________________________________________________
consensus GAGAAAGGCCAATATGGGAAAACGACGATTTTGAAGAAAGAAACGCCATGGAAGGAGGTA
 
. : . : . : . : . : . :
JMFN020D01+ CGTTTGAGCTCGGGTTGAGCTTGGCAGTATTAACGAAACCAAAGG
JMFF009J02+ CGTTTGAGCTCGGGTTGAGCTTGGCAGTACTAACGAAACCAAAGGTTATGGGCGCTGAGA
JMFS087B03+ CGTTTGAGCTCGGGTTGAGCTTGGCAGTATTAACGAAACCAAAGGTTATGGGCGCTGAGA
                      ____________________________________________________________
consensus CGTTTGAGCTCGGGTTGAGCTTGGCAGTATTAACGAAACCAAAGGTTATGGGCGCTGAGA
 
. : . : . : . : . : . :
JMFF009J02+ AAACCGCAGAGAAAGCCATTGGTGACGTCACTCTGGTATGGCGTAGGGTAAGAG
JMFS087B03+ AAACCGCAGAGAAAGCCATTGGTGACGTCACTCTGGTATGGCGTAGGGTAAGAGGGTTAA
                      ____________________________________________________________
consensus AAACCGCAGAGAAAGCCATTGGTGACGTCACTCTGGTATGGCGTAGGGTAAGAGGGTTAA