Previous Contig 003573:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF024K23Sequence462003573 (3)pir|T48587|T485878e-54peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab624009361 (4)pir|T48587|T485871e-42peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab
JMFS054C09Sequence622003573 (3)pir|T48587|T485874e-59peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab
JMFS087B02Sequence618003573 (3)pir|T48587|T485874e-59peptide transporter-like protein - Arabidopsis thaliana>gb:ATT22N19_1555307 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS054C09+ ATGAGGCCAGGATGGAGCCTTGGGGCGAGA
                      ____________________________________________________________
consensus ATGAGGCCAGGATGGAGCCTTGGGGCGAGA
 
. : . : . : . : . : . :
JMFS054C09+ GGTTTCGCATTTTGTGAATGAGATTGGATTGACAATGAGATTACAAGTTGCAGAAACAAG
JMFS087B02+ ACAAGTTGCAGAAACAAG
                      ____________________________________________________________
consensus GGTTTCGCATTTTGTGAATGAGATTGGATTGACAATGAGATTACAAGTTGCAGAAACAAG
 
. : . : . : . : . : . :
JMFS054C09+ CATAATTAAGGTTGCATTGGGTGCAATTTAAAGAGTTTGGGTTTGGAGATTGGTTACCAC
JMFS087B02+ CATAATTAAGGTTGCATTGGGTGCAATTTAAAGAGTTTGGGTTTGGAGATTGGTTACCAC
                      ____________________________________________________________
consensus CATAATTAAGGTTGCATTGGGTGCAATTTAAAGAGTTTGGGTTTGGAGATTGGTTACCAC
 
. : . : . : . : . : . :
JMFS054C09+ AAGATAGATTGTTGTGAAAATGGCTATGGTCCAGTATCTGCCCAGATATGCATCAGCCAA
JMFF024K23+ CCAGTATCTGCCCAGATATGCATCAGCCAA
JMFS087B02+ AAGATAGATTGTTGTGAAAATGGCTATGGTCCAGTATCTGCCCAGATATGCATCAGCCAA
                      ____________________________________________________________
consensus AAGATAGATTGTTGTGAAAATGGCTATGGTCCAGTATCTGCCCAGATATGCATCAGCCAA
 
. : . : . : . : . : . :
JMFS054C09+ GAAACCACCAAGAACAGAGGAAGCCTGTGATATGCCCAAAAAATTGTTGACTGCATTAGC
JMFF024K23+ GAAACCACCAAGAACAGAGGAAGCCTGTGATATGCCCAAAAAATTGTTGACTGCATTAGC
JMFS087B02+ GAAACCACCAAGAACAGAGGAAGCCTGTGATATGCCCAAAAAATTGTTGACTGCATTAGC
                      ____________________________________________________________
consensus GAAACCACCAAGAACAGAGGAAGCCTGTGATATGCCCAAAAAATTGTTGACTGCATTAGC
 
. : . : . : . : . : . :
JMFS054C09+ AGAGCTGGTGAATGGCCTGTGCATAACGTAGAACATGAACGCCACCATGTTCACAGACAG
JMFF024K23+ AGAGCTGGTGAATGGCCTGTGCATAACGTAGAACATGAACGCCACCATGTTCACAGACAG
JMFS087B02+ AGAGCTGGTGAATGGCCTGTGCATAACGTAGAACATGAACGCCACCATGTTCACAGACAG
                      ____________________________________________________________
consensus AGAGCTGGTGAATGGCCTGTGCATAACGTAGAACATGAACGCCACCATGTTCACAGACAG
 
. : . : . : . : . : . :
JMFS054C09+ CCCAAAGTATGCCATTCTCTCCGCCATTTCGTTCCCAAAAATGAAGAATGCAGCAATCCA
JMFF024K23+ CCCAAAGTATGCCATTCTCTCCGCCATTTCGTTCCCAAAAATGAAGAATGCAGCAATCCA
JMFS087B02+ CCCAAAGTATGCCATTCTCTCCGCCATTTCGTTCCCAAAAATGAAGAATGCAGCAATCCA
                      ____________________________________________________________
consensus CCCAAAGTATGCCATTCTCTCCGCCATTTCGTTCCCAAAAATGAAGAATGCAGCAATCCA
 
. : . : . : . : . : . :
JMFS054C09+ ACCGCCGGTTTTGGACAAATCTGAAATGGGCTTTCCACGGATGTTGACCGGTGTAGCTCC
JMFF024K23+ ACCGCCGGTTTTGGACAAATCTGAAATGGGCTTTCCACGGATGTTGACCGGTGTAGCTCC
JMFS087B02+ ACCGCCGGTTTTGGACAAATCTGAAATGGGCTTTCCACGGATGTTGACCGGTGTAGCTCC
                      ____________________________________________________________
consensus ACCGCCGGTTTTGGACAAATCTGAAATGGGCTTTCCACGGATGTTGACCGGTGTAGCTCC
 
. : . : . : . : . : . :
JMFS054C09+ GCCTGTACTGTAACCACCGCCTAGGGCGGTCCTCCGGTCATCTGATTCAATGAAGTACAT
JMFF024K23+ GCCTGTACTGTAACCACCGCCTAGGGCGGTCCTCCGGTCATCTGATTCAATGAAGTACAT
JMFS087B02+ GCCTGTACTGTAACCACCGCCTAGGGCGGTCCTCCGGTCATCTGATTCAATGAAGTACAT
                      ____________________________________________________________
consensus GCCTGTACTGTAACCACCGCCTAGGGCGGTCCTCCGGTCATCTGATTCAATGAAGTACAT
 
. : . : . : . : . : . :
JMFS054C09+ ACCCAGCTTCTTCCTATTCGCTGGCGTGCGGCTAGGCGTTGGGATCCCCTGAGGCGCCTC
JMFF024K23+ ACCCAGCTTCTTCCTATTCGCTGGCGTGCGGCTAGGCGTTGGGATCCCCTGAGGCGCCTC
JMFS087B02+ ACCCAGCTTCTTCCTATTCGCTGGCGTGCGGCTAGGCGTTGGGATCCCCTGAGGCGCCTC
                      ____________________________________________________________
consensus ACCCAGCTTCTTCCTATTCGCTGGCGTGCGGCTAGGCGTTGGGATCCCCTGAGGCGCCTC
 
. : . : . : . : . : . :
JMFS054C09+ CGGGGACCTGATTTCTTTGCCGCTCATGCCTTAATAATTGGGAGATATTGGA
JMFF024K23+ CGGGGACCTGATTTCTTTGCCGCTCATGCCTTAATAATTGGGAGATATTGGATACTGAAG
JMFS087B02+ CGGGGACCTGATTTCTTTGCCGCTCATGCCTTAATAATTGGGAGATATTGGATACTGAAG
                      ____________________________________________________________
consensus CGGGGACCTGATTTCTTTGCCGCTCATGCCTTAATAATTGGGAGATATTGGATACTGAAG
 
. : . : . : . : . : . :
JMFF024K23+ CGACTTGGAGAT
JMFS087B02+ CGACTTGGAGATACACATACAGAGATTGGGGAATCTTTAAATTCTTCTTCTCCCAAATGG
                      ____________________________________________________________
consensus CGACTTGGAGATACACATACAGAGATTGGGGAATCTTTAAATTCTTCTTCTCCCAAATGG