Previous Contig 003568:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007E23Sequence347000371 (2)505003568 (8)gb:LEY14810_16848142e-34Lycopersicon esculentum partial mRNA for beta-carotene hydroxylase (CrtR-b2 gene
JMFF046D23Sequence564000371 (2)gb:AY136358_15818595e-16Arabidopsis thaliana unknown protein (At1g19880) mRNA, complete cds.>gb:BT000200454003568 (8)gb:LEY14810_16848141e-39Lycopersicon esculentum partial mRNA for beta-carotene hydroxylase (CrtR-b2 gene
JMFN032K06Sequence629003568 (8)gb:AF315289_17853832e-95Citrus unshiu beta-carotene hydroxylase (CHX2) mRNA, complete cds.
JMFS086E08Sequence606003568 (8)gb:CQ788413_14528254e-23Sequence 83 from Patent WO2004018695.
JMFS086F07Sequence618003568 (8)gb:CABCH2_16447383e-25C.annuum mRNA for beta-carotene hydroxylase 2, partial.
JMFS151F06Sequence626003568 (8)gb:CABCH2_16447384e-47C.annuum mRNA for beta-carotene hydroxylase 2, partial.
JMSF030P12Sequence661003568 (8)gb:CABCH2_16447381e-47C.annuum mRNA for beta-carotene hydroxylase 2, partial.669003568 (8)gb:AF315289_17853832e-75Citrus unshiu beta-carotene hydroxylase (CHX2) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046D23- CCCTTATGGCGGATCACCCGGAGAGTTTTTTTTT
                      ____________________________________________________________
consensus CCCTTATGGCGGATCACCCGGAGAGTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF046D23- TTTTTTCTTCAAGGCAAAAAGTAGGAGATCATTTCATTAATTAATAACGTTTTTTTTTTC
rJMFF007E23- CATTAATTAATAACGNTTTTTTTTTC
rJMSF030P12- TTTTTTTTTC
                      ____________________________________________________________
consensus TTTTTTCTTCAAGGCAAAAAGTAGGAGATCATTTCATTAATTAATAACGTTTTTTTTTTC
 
. : . : . : . : . : . :
rJMFF046D23- TTTTTTTCTTTCTTCTTTTCCTCTACATTATGAACACATAAAGATTTTATGTCTCAAAAC
rJMFF007E23- TTTTTTTCTTTCTTCTTTTCCTCTACATTATGAATACATAAAGATTTTATGTCTCAAANC
rJMSF030P12- TTTTTTTCTTTCTTCTTTTCCTCTACATTANGAATACATAAAGATTTTATGCCTCAAAAC
                      ____________________________________________________________
consensus TTTTTTTCTTTCTTCTTTTCCTCTACATTATGAATACATAAAGATTTTATGTCTCAAAAC
 
. : . : . : . : . : . :
rJMFF046D23- CCCCCTTAGCTTGGGATGCATGTTATGATCATTATCGTCCCTTACTAGACATCTTGATTC
rJMFF007E23- CCCCCTTAGCTTGGGATGCNTGTTATGATCATTATCGTCCCTTACTAAACNTCTTGATTC
rJMSF030P12- CCCCCTTAGCTTGGGATGCANGTTATGATCATTATCGTCCCTTACTANACATCTTGATTC
                      ____________________________________________________________
consensus CCCCCTTAGCTTGGGATGCATGTTATGATCATTATCGTCCCTTACTAGACATCTTGATTC
 
. : . : . : . : . : . :
rJMFF046D23- TTCGGTTCACTTCGACCTCCAAGTCATTTAGCCCTCCAACTTCTTCCAATTCCTTGGGTC
rJMFF007E23- TTCGGTTCACTTCNACCTCCAAGTCNTTTACCCCTCCAACTTCTTCCAATTCCTTGGGTC
rJMSF030P12- TTCGGTTCACTTCGACCTCCAAGTCATTTAGCCCTCCAACTTCTTCCAATTCCTTGGGTC
                      ____________________________________________________________
consensus TTCGGTTCACTTCGACCTCCAAGTCATTTAGCCCTCCAACTTCTTCCAATTCCTTGGGTC
 
. : . : . : . : . : . :
rJMFF046D23- CTAAAAACAAGCCATATGGGACACCGTTGAACTTGTCGGTATGGTGCAGCTGGTGCGCCG
rJMFF007E23- CTAAAAACNANCCNTATGGGACACCGTTGAANTTGTCGGTATGGTGCAGNTGGNGCGCCG
rJMSF030P12- CTAAAAACAAGCCATATGGGACACCGTTGAACTTGTCGGTATGGNGCAGCTGGNGCGCCG
JMFN032K06+ TATGGGACACCGTTGAACTTGTCGGTATGGTGCAGCTGGTGCGCCG
                      ____________________________________________________________
consensus CTAAAAACAAGCCATATGGGACACCGTTGAACTTGTCGGTATGGTGCAGCTGGTGCGCCG
 
. : . : . : . : . : . :
rJMFF046D23- CGGCCACTCTCCTAAAATAAGGCACGTCGGCGATGGGCCCCACGGGGAATCGCTTGTGAA
rJMFF007E23- CGGCCNCTCTCCTAAAATAAGGCACGTCGGCGATGGNCCCCANGGGGAATCGCTTGTGAA
rJMSF030P12- CGGCCACTCTCCTAAAATAAGGCACGTCGGCNATGGGCCCCACGGGGAATCGCTTGTGAA
JMFN032K06+ CGGCCACTCTCCTAAAATAAGGCACGTCGGCGATGGGCCCCACGGGGAATCGCTTGTGAA
                      ____________________________________________________________
consensus CGGCCACTCTCCTAAAATAAGGCACGTCGGCGATGGGCCCCACGGGGAATCGCTTGTGAA
 
. : . : . : . : . : . :
rJMFF046D23- CAAGCCCATCGTGGACGAACATGTAGGCCATCCCGAACACTGTGATTCCA
rJMFF007E23- CAANCCCATNGNGGACNAACNTGTAGGCCATCCCNAACACTGTGATTCCANCCCCACCTC
rJMSF030P12- CAAGCCCATCGNGGACNAACATGTAGGCCATCCCGAACACTGTGATTCCAAGCCCAGCTC
JMFN032K06+ CAAGCCCATCGTGGACGAACATGTAGGCCATCCCGAACACTGTGATTCCAAGCCCAGCTC
                      ____________________________________________________________
consensus CAAGCCCATCGTGGACGAACATGTAGGCCATCCCGAACACTGTGATTCCAAGCCCAGCTC
 
. : . : . : . : . : . :
rJMFF007E23- CGAAGCANAGGCCAGGAACAAAACCTTTGTGGAAAAAACCGTAGNAAANAAAANCGATGG
rJMSF030P12- CNAAGCAAAGGCCAGGAACAANACCTTTGTGGAANAAACCGTAGGANANAANAGCGATGG
JMFN032K06+ CGAAGCAGAGGCCAGGAACAAGACCTTTGTGGAAGAAACCGTAGGAGAGAAGAGCGATGG
                      ____________________________________________________________
consensus CGAAGCAGAGGCCAGGAACAAGACCTTTGTGGAAGAAACCGTAGGAGAGAAGAGCGATGG
 
. : . : . : . : . : . :
rJMFF007E23- CAGGGACAGCNTTAGTTATGGCNAAAACATCGTTGANCTCNAACGGTCCTTNTCTTG
rJMSF030P12- CAGGGACAGCGTTAGTTATGGCGAAAACATCGTTGAGCTCGAACGGNCCTTCTCTTGGTC
JMFN032K06+ CAGGGACAGCGTTAGTTATGGCGAAAACATCGTTGAGCTCGAACGGTCCTTCTCTTGGTC
JMSF030P12+ TGAGCTCGAACGGTCCTTCTCTTGGTC
JMFS151F06+ TGAGCTCGAACGGTCCTTCTCTTGGTC
                      ____________________________________________________________
consensus CAGGGACAGCGTTAGTTATGGCGAAAACATCGTTGAGCTCGAACGGTCCTTCTCTTGGTC
 
. : . : . : . : . : . :
rJMSF030P12- TGTGGNGAGACTCGNGCATGTGCCATAACNAAGCGTGCCATAGCGCTCTGTGAGCCCATC
JMFN032K06+ TGTGGTGAGACTCGTGCATGTGCCATAACGAAGCGTGCCATAGCGCTCTGTGAGCCCATC
JMSF030P12+ TGTGGTGAGACTCGTGCATGTGCCATAACGAAGCGTGCCATAGCGCTCTGTGAGCCCATC
JMFS151F06+ TGTGGTGAGACTCGTGCATGTGCCATAACGAAGCGTGCCATAGCGCTCTGTGAGCCCATC
                      ____________________________________________________________
consensus TGTGGTGAGACTCGTGCATGTGCCATAACGAAGCGTGCCATAGCGCTCTGTGAGCCCATC
 
. : . : . : . : . : . :
rJMSF030P12- TCGCCCAGAATTCCATTCCCACCGCGGCTCCGACGGAGAGAGCAAATGTACCGAACATCT
JMFN032K06+ TTGCCCAGAATTCCATTCCCACCGCGGCTCCGACGGAGAGAGCAAATGTACCGAACATCT
JMSF030P12+ TCGCCCAGAATTCCATTCCCACCGCGGCTCCGACGGAGAGAGCAAATGTACCGAACATCT
JMFS151F06+ TCGCCCAGAATTCCATTCCCACCGCGGCTCCGACGGAGAGAGCAAATGTACCGAACATCT
                      ____________________________________________________________
consensus TCGCCCAGAATTCCATTCCCACCGCGGCTCCGACGGAGAGAGCAAATGTACCGAACATCT
 
. : . : . : . : . : . :
rJMSF030P12- CAGTATATGGAACTTCTCCTCCCTCCATTTGCCAAGCGAATCTGTAATAAACAGCGA
JMFN032K06+ CAGTATATGGAACTTCTCCTCCCTCCATTTGCCAAGCGAATCTGTAATAAACAGCGAGAA
JMSF030P12+ CAGTATATGGAACTTCTCCTCCCTCCATTTGCCAAGCGAATCTGTAATAAACAGCGAGAA
JMFS151F06+ CAGTATATGGAACTTCTCCTCCCTCCATTTGCCAAGCGAATCTGTAATAAACAGCGAGAA
JMFS086F07+ CCTCCATTTGCCAAGCGAATCTGTAATAAACAGCGAGAA
JMFS086E08+ CCTCCATTTGCCAAGCGAATCTGTAATAAACAGCGAGAA
                      ____________________________________________________________
consensus CAGTATATGGAACTTCTCCTCCCTCCATTTGCCAAGCGAATCTGTAATAAACAGCGAGAA
 
. : . : . : . : . : . :
JMFN032K06+ CCGCCATGGACGTAATCCCCAAGCTCGACATCACGGCGGCGACGAGATAAGTGAAGCGCT
JMSF030P12+ CCGCCATGGACGTAATCCCCAAGCTCGACATCACGGCGGCGACGAGATAAGTGAAGCGCT
JMFS151F06+ CCGCCATGGACGTAATCCCCAAGCTCGACATCACGGCGGCGACGAGATAAGTGAAGCGCT
JMFS086F07+ CCGCCATGGACGTAATCCCCAAGCTCGACATCACGGCGGCGACGAGATAAGTGAAGCGCT
JMFS086E08+ CCGCCATGGACGTAATCCCCAAGCTCGACATCACGGCGGCGACGAGATAAGTGAAGCGCT
                      ____________________________________________________________
consensus CCGCCATGGACGTAATCCCCAAGCTCGACATCACGGCGGCGACGAGATAAGTGAAGCGCT
 
. : . : . : . : . : . :
JMFN032K06+ CCGATCTTTTCCTGGCCAATTTCTCCGCCAAGCGAGAAGCCGAGATCTGCTTCTCTATCG
JMSF030P12+ CCGATCTTTTCCTGGCCAATTTCTCCGCCAAGCGAGAAGCCGAGATCTGCTTCTCTATCG
JMFS151F06+ CCGATCTTTTCCTGGCCAATTTCTCCGCCAAGCGAGAAGCCGAGATCTGCTTCTCTATCG
JMFS086F07+ CCGATCTTTTCCTGGCCAATTTCTCCGCCAAGCGAGAAGCCGAGATCTGCTTCTCTATCG
JMFS086E08+ CCGATCTTTTCCTGGCCAATTTCTCCGCCAAGCGAGAAGCCGAGATCTGCTTCTCTATCG
                      ____________________________________________________________
consensus CCGATCTTTTCCTGGCCAATTTCTCCGCCAAGCGAGAAGCCGAGATCTGCTTCTCTATCG
 
. : . : . : . : . : . :
JMFN032K06+ CTCTCTCAATCTCCTCCGCCCGGATTTCAA
JMSF030P12+ CTCTCTCAATCTCCTCCGCCCGGATTTCAACTCCTCCGGACTCTAACTTTTCATCTTCCA
JMFS151F06+ CTCTCTCAATCTCCTCCGCCCGGATTTCAACTCCTCCGGACTCTAACTTTTCATCTTCCA
JMFS086F07+ CTCTCTCAATCTCCTCCGCCCGGATTTCAACTCCTCCGGACTCTAACTTTTCATCTTCCA
JMFS086E08+ CTCTCTCAATCTCCTCCGCCCGGATTTCAACTCCTCCGGACTCTAACTTTTCATCTTCCA
                      ____________________________________________________________
consensus CTCTCTCAATCTCCTCCGCCCGGATTTCAACTCCTCCGGACTCTAACTTTTCATCTTCCA
 
. : . : . : . : . : . :
JMSF030P12+ GAACGAAGCAGACCGTCAGGCTAGGTTTTCTTCGAGACCTCAGAACCGAGCTGCGAAATC
JMFS151F06+ GAACGAAGCAGACCGTCAGGCTAGGTTTTCTTCGAGACCTCAGAACCGAGCTGCGAAATC
JMFS086F07+ GAACGAAGCAGACCGTCAGGCTAGGTTTTCTTCGAGACCTCAGAACCGAGCTGCGAAATC
JMFS086E08+ GAACGAAGCAGACCGTCAGGCTAGGTTTTCTTCGAGACCTCAGAACCGAGCTGCGAAATC
                      ____________________________________________________________
consensus GAACGAAGCAGACCGTCAGGCTAGGTTTTCTTCGAGACCTCAGAACCGAGCTGCGAAATC
 
. : . : . : . : . : . :
JMSF030P12+ GCCGACTTAAAGGACTAAACAGTAAACTCGGCGGGGAAGCGGAGTGAGTAGCGGGGCGGA
JMFS151F06+ GCCGACTTAAAGGACTAAACAGTAAACTCGGCGGGGAAGCGGAGTGAGTAGCGGGGCGGA
JMFS086F07+ GCCGACTTAAAGGACTAAACAGTAAACTCGGCGGGGAAGCGGAGTGAGTAGCGGGGCGGA
JMFS086E08+ GCCGACTTAAAGGACTAAACAGTAAACTCGGCGGGGAAGCGGAGTGAGTAGCGGGGCGGA
                      ____________________________________________________________
consensus GCCGACTTAAAGGACTAAACAGTAAACTCGGCGGGGAAGCGGAGTGAGTAGCGGGGCGGA
 
. : . : . : . : . : . :
JMSF030P12+ CCAATGAG
JMFS151F06+ CCAATGAGAACTGGCAGCTGTAGACGGTTCGAGAGCTGGCCGCAATGGAAATTCCGACCG
JMFS086F07+ CCAATGAGAACTGGCAGCTGTAGACGGTTCGAGAGCTGGCCGCAATGGAAATTCCGACCG
JMFS086E08+ CCAATGAGAACTGGCAGCTGTAGACGGTTCGAGAGCTGGCCGCAATGGAAATTCCGACCG
                      ____________________________________________________________
consensus CCAATGAGAACTGGCAGCTGTAGACGGTTCGAGAGCTGGCCGCAATGGAAATTCCGACCG
 
. : . : . : . : . : . :
JMFS151F06+ CCATAGACGGCGGAGGTTGTAAGCACGGCGTTAAGGTTAAGAGGAGAAGGGAGGAGAGA
JMFS086F07+ CCATAGACGGCGGAGGTTGTAAGCACGGCGTTAAGGTTAAGAGGAGAAGGGAGGAGAGA
JMFS086E08+ CCATAGACGGCGGAGGTTGTAAGCACGGCGTTAAGGTTAAGAGGAGAAGGGAGGAGAGAG
                      ____________________________________________________________
consensus CCATAGACGGCGGAGGTTGTAAGCACGGCGTTAAGGTTAAGAGGAGAAGGGAGGAGAGAG