Previous Contig 003564:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009F19Sequence563003564 (2)gb:AY074393_15675461e-96Arabidopsis thaliana putative beta-amylase (At3g23920) mRNA, complete cds.>gb:AY
JMFS086B07Sequence627003564 (2)gb:AY074393_1567546e-110Arabidopsis thaliana putative beta-amylase (At3g23920) mRNA, complete cds.>gb:AY

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF009F19+ ATGCAGGT
                      ____________________________________________________________
consensus ATGCAGGT
 
. : . : . : . : . : . :
JMFF009F19+ GAAGTNGAAGATGGCGCCGTGGCGGGCGAGCATTTGGGCGATGGGGAGATAGCCGTCTCG
JMFS086B07+ TGGGCGATGGGGAGATAGCCGTCTCG
                      ____________________________________________________________
consensus GAAGTNGAAGATGGCGCCGTGGCGGGCGAGCATTTGGGCGATGGGGAGATAGCCGTCTCG
 
. : . : . : . : . : . :
JMFF009F19+ GAAACGGGTGTTGTAGTAGCCGGCGGTGAGCTCTGGGGCGTGGGATCGGGTGCCGTAGTG
JMFS086B07+ GAAACGGGTGTTGTAGTAGCCGGCGGTGAGCTCTGGGGCGTGGGATCGGGTGCCGTAGTG
                      ____________________________________________________________
consensus GAAACGGGTGTTGTAGTAGCCGGCGGTGAGCTCTGGGGCGTGGGATCGGGTGCCGTAGTG
 
. : . : . : . : . : . :
JMFF009F19+ CCAGTGGATTCCGGCAATCTTCACTGATATTTTGACGCCCGTGTTGTCGAATATAGCGTT
JMFS086B07+ CCAGTGGATTCCGGCAATCTTCACTGATATTTTGACGCCCGTGTTGTCGAATATAGCGTT
                      ____________________________________________________________
consensus CCAGTGGATTCCGGCAATCTTCACTGATATTTTGACGCCCGTGTTGTCGAATATAGCGTT
 
. : . : . : . : . : . :
JMFF009F19+ GGCTGATTGTAGTATCCTCTCGCCATGGTCCAGAAGCATCTGGGAGTACCAAGAGAGGAA
JMFS086B07+ GGCTGATTGTAGTATCCTCTCGCCATGGTCCAGAAGCATCTGGGAGTACCAAGAGAGGAA
                      ____________________________________________________________
consensus GGCTGATTGTAGTATCCTCTCGCCATGGTCCAGAAGCATCTGGGAGTACCAAGAGAGGAA
 
. : . : . : . : . : . :
JMFF009F19+ GAATTCGCCGTACGGGGTGGTCCAACCGCCTTCTTTCCTGAAAAAGTTTGTGTCTTCAGG
JMFS086B07+ GAATTCGCCGTACGGGGTGGTCCAACCGCCTTCTTTCCTGAAAAAGTTTGTGTCTTCAGG
                      ____________________________________________________________
consensus GAATTCGCCGTACGGGGTGGTCCAACCGCCTTCTTTCCTGAAAAAGTTTGTGTCTTCAGG
 
. : . : . : . : . : . :
JMFF009F19+ CCAGTTGTTGTAGTGGCCAGCGTCTGTCGGGCCACTATGCCCCCATTCTGGCTTACCAAT
JMFS086B07+ CCAGTTGTTGTAGTGGCCAGCGTCTGTCGGGCCACTATGCCCCCATTCTGGCTTACCAAT
                      ____________________________________________________________
consensus CCAGTTGTTGTAGTGGCCAGCGTCTGTCGGGCCACTATGCCCCCATTCTGGCTTACCAAT
 
. : . : . : . : . : . :
JMFF009F19+ TGCTTCAGCTGTGGCTCTCAGGCTGCTAATCATGTACTTATCAAAGCACTGAAAAGCCCC
JMFS086B07+ TGCTTCAGCTGTGGCTCTCAGGCTGCTAATCATGTACTTATCAAAGCACTGAAAAGCCCC
                      ____________________________________________________________
consensus TGCTTCAGCTGTGGCTCTCAGGCTGCTAATCATGTACTTATCAAAGCACTGAAAAGCCCC
 
. : . : . : . : . : . :
JMFF009F19+ AATTCCAGGGAATTTCCATGTCCCATTCTGCTCTGGATATGAAGGATAACGGAGCTCTCC
JMFS086B07+ AATTCCAGGGAATTTCCATGTCCCATTCTGCTCTGGATATGAAGGATAACGGAGCTCTCC
                      ____________________________________________________________
consensus AATTCCAGGGAATTTCCATGTCCCATTCTGCTCTGGATATGAAGGATAACGGAGCTCTCC
 
. : . : . : . : . : . :
JMFF009F19+ AGCTGGACCCATGCCAACTTGAATTTCCACTATAGTGTCACCCAGCAAGTGCTCAAATCT
JMFS086B07+ AGCTGGACCCATGCCAACTTGAATTTCCACTATAGTGTCACCCAGCAAGTGCTCAAATCT
                      ____________________________________________________________
consensus AGCTGGACCCATGCCAACTTGAATTTCCACTATAGTGTCACCCAGCAAGTGCTCAAATCT
 
. : . : . : . : . : . :
JMFF009F19+ GTCTCTGAAAGCCCT
JMFS086B07+ GTCTCTGAAAGCCCTCATGAAGTCAGAATAACACTGGACAGGTGTTCTTCCTTTTAGGAC
                      ____________________________________________________________
consensus GTCTCTGAAAGCCCTCATGAAGTCAGAATAACACTGGACAGGTGTTCTTCCTTTTAGGAC
 
. : . : . : . : . : . :
JMFS086B07+ TGGAAGGGTATCACAACCAAGTGACACATACTCATAATTCCTCCTCCCCCATTGATCTGT
                      ____________________________________________________________
consensus TGGAAGGGTATCACAACCAAGTGACACATACTCATAATTCCTCCTCCCCCATTGATCTGT