Previous Contig 003563:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019B23Sequence544003563 (5)gb:AB093586_15252284e-50Arabidopsis thaliana CMO-like mRNA for choline monooxygenase, complete cds.754003563 (5)gb:AB093586_15252281e-90Arabidopsis thaliana CMO-like mRNA for choline monooxygenase, complete cds.
JMFS086A11Sequence612003563 (5)gb:AB093586_15252288e-53Arabidopsis thaliana CMO-like mRNA for choline monooxygenase, complete cds.
JMSF013N23Sequence291003563 (5)gb:AB093586_15252282e-07Arabidopsis thaliana CMO-like mRNA for choline monooxygenase, complete cds.693003563 (5)sp|Q9SZR0|CHMO_ARATH7e-73Probable choline monooxygenase, chloroplast precursor (EC 1.14.15.7).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013N23- CATGCAAAATAGAGTATAGACAGTCATAACATAATCAAACTTCTTCACCCATCAAGAAA
                      ____________________________________________________________
consensus CATGCAAAATAGAGTATAGACAGTCATAACATAATCAAACTTCTTCACCCATCAAGAAA
 
. : . : . : . : . : . :
rJMSF013N23- GAGCTTTTTCCAGGATGAAAATGCATGTAGAATACACTCTGTAGGTTGGTACAAATTTAT
                      ____________________________________________________________
consensus GAGCTTTTTCCAGGATGAAAATGCATGTAGAATACACTCTGTAGGTTGGTACAAATTTAT
 
. : . : . : . : . : . :
rJMSF013N23- TAGATCACACCCCACCCTGAATGAGAGTTTCAAAGGCAAAGATTTTGGTGAAGTAGGCAG
                      ____________________________________________________________
consensus TAGATCACACCCCACCCTGAATGAGAGTTTCAAAGGCAAAGATTTTGGTGAAGTAGGCAG
 
. : . : . : . : . : . :
rJMSF013N23- TGGAAATGATGCATTGGCTTCTCAACACTTGGCGCATACCGGCCGCACACATATGCTGGT
                      ____________________________________________________________
consensus TGGAAATGATGCATTGGCTTCTCAACACTTGGCGCATACCGGCCGCACACATATGCTGGT
 
. : . : . : . : . : . :
rJMSF013N23- GATTCCAACCCTCTCTGAACGCCTTCACATAATGACATATCCTCCATCTGAACTCTCTCA
                      ____________________________________________________________
consensus GATTCCAACCCTCTCTGAACGCCTTCACATAATGACATATCCTCCATCTGAACTCTCTCA
 
. : . : . : . : . : . :
rJMSF013N23- CTGTCTTCCAAGCTTCTTTCTATAAATTCATTATCACCCTTTAAAGAAGTGTCTAGAAAA
                      ____________________________________________________________
consensus CTGTCTTCCAAGCTTCTTTCTATAAATTCATTATCACCCTTTAAAGAAGTGTCTAGAAAA
 
. : . : . : . : . : . :
rJMSF013N23- TAATCGAATATCACTTGACATTTGCGAGGTCCCAGTGGCACTACAAGATTGGTGTCCATC
                      ____________________________________________________________
consensus TAATCGAATATCACTTGACATTTGCGAGGTCCCAGTGGCACTACAAGATTGGTGTCCATC
 
. : . : . : . : . : . :
rJMSF013N23- CAAGGCCCATACCTATTAATCATGAAGTTTGGAAAAACAAAAGCATATGTAGCTTTTGAC
                      ____________________________________________________________
consensus CAAGGCCCATACCTATTAATCATGAAGTTTGGAAAAACAAAAGCATATGTAGCTTTTGAC
 
. : . : . : . : . : . :
rJMSF013N23- CCCAATCGGTCAAATTCATCCTCTGTGGTCCCACCAAGACACTGTTGGATGCTAACTCTC
                      ____________________________________________________________
consensus CCCAATCGGTCAAATTCATCCTCTGTGGTCCCACCAAGACACTGTTGGATGCTAACTCTC
 
. : . : . : . : . : . :
rJMSF013N23- TCAAATATCTCAGTGGAGTACGTTTCAAGCTTGAGATCAGAAGCAAGAGATTTATGTGCA
rJMFF019B23- CTCAGTGGAGTACGTTTCAAGCTTGAGATCAGAAGCAAGAGATTTATGTGCA
                      ____________________________________________________________
consensus TCAAATATCTCAGTGGAGTACGTTTCAAGCTTGAGATCAGAAGCAAGAGATTTATGTGCA
 
. : . : . : . : . : . :
rJMSF013N23- AATGGGACATGATAACCACCATCTAAGTAATTGTCACAGAACACCTTCCAATTACATTCA
rJMFF019B23- AATGGGACATGATAACCACCATCTAAGTAATTGTCACAGAACACCTTCCAATTACATTCA
                      ____________________________________________________________
consensus AATGGGACATGATAACCACCATCTAAGTAATTGTCACAGAACACCTTCCAATTACATTCA
 
. : . : . : . : . : . :
rJMSF013N23- ATGGTATATTCACGTCTGCAAACATAACTCAGAG
rJMFF019B23- ATGGTATATTCACGTCTGCAAACATAACTCAGAGAAGAATCAATTCCATTTGCAATCAGG
                      ____________________________________________________________
consensus ATGGTATATTCACGTCTGCAAACATAACTCAGAGAAGAATCAATTCCATTTGCAATCAGG
 
. : . : . : . : . : . :
rJMFF019B23- ATTTCAGATGAACTACCCAGCCATTCATTTCCCACAGGGACAGTCTCGGATTCGTGTTCA
                      ____________________________________________________________
consensus ATTTCAGATGAACTACCCAGCCATTCATTTCCCACAGGGACAGTCTCGGATTCGTGTTCA
 
. : . : . : . : . : . :
rJMFF019B23- GGAGAAACAGCAGCATCAAAATTGAGAAGCACAAATGGACCCCAAATAGCCACTTTCAAT
JMFS086A11+ GCCACTTTCAAT
                      ____________________________________________________________
consensus GGAGAAACAGCAGCATCAAAATTGAGAAGCACAAATGGACCCCAAATAGCCACTTTCAAT
 
. : . : . : . : . : . :
rJMFF019B23- GGAATGAGTCCCATCTCCTACCATTCACTTCAAATTTCTGAATCCCGGTTAGTCTAGTAG
JMFF019B23+ TTAGTCTAGTAG
JMFS086A11+ GGAATGAGTCCCATCTCCTACCATTCACTTCAAATTTCTGAATCCCGGTTAGTCTAGTAG
                      ____________________________________________________________
consensus GGAATGAGTCCCATCTCCTACCATTCACTTCAAATTTCTGAATCCCGGTTAGTCTAGTAG
 
. : . : . : . : . : . :
rJMFF019B23- CCTTGAGAAGGGCTCCATCCAACCCATATGTCCAGCCATGGTATGGGCACACAAAGCATG
JMFF019B23+ CCTTGAGAAGGGCTCCATCCAACCCATATGTCCAGCCATGGTATGGGCACACAAAGCATG
JMFS086A11+ CCTTGAGAAGGGCTCCATCCAACCCATATGTCCAGCCATGGTATGGGCACACAAAGCATG
                      ____________________________________________________________
consensus CCTTGAGAAGGGCTCCATCCAACCCATATGTCCAGCCATGGTATGGGCACACAAAGCATG
 
. : . : . : . : . : . :
rJMFF019B23- TTCTTTTCCCACTGCCAGAAGCCAAAACAGAGGCATGATGCCGACATACATTATGAAATG
JMFF019B23+ TTCTTTTCCCACTGCCAGAAGCCAAAACAGAGGCATGATGCCGACATACATTATGAAATG
JMFS086A11+ TTCTTTTCCCACTGCCAGAAGCCAAAACAGAGGCATGATGCCGACATACATTATGAAATG
                      ____________________________________________________________
consensus TTCTTTTCCCACTGCCAGAAGCCAAAACAGAGGCATGATGCCGACATACATTATGAAATG
 
. : . : . : . : . : . :
rJMFF019B23- CTTGTATTTTGCCACTGTCATCTCGACATACCACATATTCAATGTTTCCTAATCTGCCGG
JMFF019B23+ CTTGTATTTTGCCACTGTCATCTCGACATACCACATATTCAATGTTTCCTAATCTGCCGG
JMFS086A11+ CTTGTATTTTGCCACTGTCATCTCGACATACCACATATTCAATGTTTCCTAATCTGCCGG
                      ____________________________________________________________
consensus CTTGTATTTTGCCACTGTCATCTCGACATACCACATATTCAATGTTTCCTAATCTGCCGG
 
. : . : . : . : . : . :
rJMFF019B23- TAAAAAATTGGCGGGGTTCATTGACTTGCTCAGTGTAGCCAACTGCCTGCCAGCCTCTGT
JMFF019B23+ TAAAAAATTGGCGGGGTTCATTGACTTGCTCAGTGTAGCCAACTGCCTGCCAGCCTCTGT
JMFS086A11+ TAAAAAATTGGCGGGGTTCATTGACTTGCTCAGTGTAGCCAACTGCCTGCCAGCCTCTGT
                      ____________________________________________________________
consensus TAAAAAATTGGCGGGGTTCATTGACTTGCTCAGTGTAGCCAACTGCCTGCCAGCCTCTGT
 
. : . : . : . : . : . :
rJMFF019B23- AGAAGACGCGAGAGAGCTCGAGAGAGTAAAAGGAGGGATCGGTGTACCAGGAGGTGGGCG
JMFF019B23+ AGAAGACGCGAGAGAGCTCGAGAGAGTAAAAGGAGGGATCGGTGTACCAGGAGGTGGGCG
JMSF013N23+ ACGCGAGAGAGCTCGAGAGAGTAAAAGGAGGGATCGGTGTACCAGGAGGTGGGCG
JMFS086A11+ AGAAGACGCGAGAGAGCTCGAGAGAGTAAAAGGAGGGATCGGTGTACCAGGAGGTGGGCG
                      ____________________________________________________________
consensus AGAAGACGCGAGAGAGCTCGAGAGAGTAAAAGGAGGGATCGGTGTACCAGGAGGTGGGCG
 
. : . : . : . : . : . :
rJMFF019B23- GGGTTTGCGCTTCTTCAATGGGGATATCCGGGNTGAATTCTCGAGTCAGAGAAAAGCTCG
JMFF019B23+ GGGTTTGCGCTTCTTCAATGGGGATATCCGGGTTGAATTCTCGAGTCAGAGAAAAGCTCG
JMSF013N23+ GGGTTTGCGCTTCTTCAATGGGGATATCCGGGTTGAATTCTCGAGTCAGAGAAAAGCTCG
JMFS086A11+ GGGTTTGCGCTTCTTCAATGGGGATATCCGGGTTGAATTCTCGAGTCAGAGAAAAGCTCG
                      ____________________________________________________________
consensus GGGTTTGCGCTTCTTCAATGGGGATATCCGGGTTGAATTCTCGAGTCAGAGAAAAGCTCG
 
. : . : . : . : . : . :
rJMFF019B23- CGTTCCCGCAACTCAGTGGCAAAACTCCGA
JMFF019B23+ CGTTCCCGCAACTCAGTGGCAAAACTCCGAGACGGAGACGGTGCATCCCGTTTGTGAATT
JMSF013N23+ CGTTCCCGCAACTCAGTGGCAAAACTCCGAGACGGAGACGGTGCATCCCGTTTGTGAATT
JMFS086A11+ CGTTCCCGCAACTCAGTGGCAAAACTCCGAGACGGAGACGGTGCATCCCGTTTGTGAATT
                      ____________________________________________________________
consensus CGTTCCCGCAACTCAGTGGCAAAACTCCGAGACGGAGACGGTGCATCCCGTTTGTGAATT
 
. : . : . : . : . : . :
JMFF019B23+ GCAGACGCCAATATCGAGGAGTCGACAGCGCTGAGGGCTCTCTCCTGTGAACGGAAAACG
JMSF013N23+ GCAGACGGCAATATCGAGGAGTCGACAGCGCTGAGGGCTCTCTCCTGTGAACGGAAAACG
JMFS086A11+ GCAGACGGCAATATCGAGGAGTCGACAGCGCTGAGGGCTCTCTCCTGTGAACGGAAAACG
                      ____________________________________________________________
consensus GCAGACGGCAATATCGAGGAGTCGACAGCGCTGAGGGCTCTCTCCTGTGAACGGAAAACG
 
. : . : . : . : . : . :
JMFF019B23+ GAATCGTGGCAGCGATACAACCTGAAGCCATGGATGTGGTCTTTCCAGAGTT
JMSF013N23+ GAATCGTGGCAGCGATACAACCTGAAGCCATGGATGTGGTCTTTCCAGAGTT
JMFS086A11+ GAATCGTGGCAGCGATACAACCTGAAGCCATGGATGTGGTCTTTCCAGAGTTACCACTCT
                      ____________________________________________________________
consensus GAATCGTGGCAGCGATACAACCTGAAGCCATGGATGTGGTCTTTCCAGAGTTACCACTCT