Previous Contig 003560:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E11Sequence260003560 (33)741010250 (16)pir|T05565|T055652e-34hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF006P16Sequence569003560 (33)gb:AP004079_18373672e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10834010250 (16)pir|T05565|T055658e-35hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF019D23Sequence579003560 (33)gb:AP004079_18373674e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10722010250 (16)pir|T05565|T055656e-35hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF021K16Sequence504003560 (33)gb:AP004079_18373673e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10711010250 (16)pir|T05565|T055656e-35hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF026N17Sequence535003560 (33)pir|T05565|T055653e-23hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab730010250 (16)pir|T05565|T055657e-35hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF030O18Sequence513003560 (33)gb:AP004079_18373675e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10627010250 (16)pir|T05565|T055653e-34hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF034N09Sequence536003560 (33)pir|T05565|T055652e-11hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab732010250 (16)pir|T05565|T055657e-35hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF035M19Sequence526003560 (33)691010250 (16)pir|T05565|T055656e-35hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF037E15Sequence564003560 (33)gb:AP004079_18373674e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10543010250 (16)pir|T05565|T055651e-33hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFF042M07Sequence650003560 (33)gb:AP004079_18373676e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10604010250 (16)pir|T05565|T055651e-34hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFS015H01Sequence575003560 (33)pir|T05565|T055657e-24hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFS018A08Sequence622003560 (33)gb:AP004079_18373675e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS037H05Sequence594003560 (33)gb:AP004079_18373674e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS051G10Sequence454003560 (33)gb:AP004079_18373672e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS068D10Sequence622003560 (33)gb:AP004079_18373675e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS072G02Sequence627003560 (33)gb:AP004079_18373676e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS075E04Sequence627003560 (33)gb:AP004079_18373676e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS076A10Sequence617003560 (33)gb:AP004079_18373673e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS077F03Sequence626003560 (33)gb:AP004079_18373676e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS077H04Sequence538003560 (33)gb:AP004079_18373675e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS085G06Sequence627003560 (33)gb:AP004079_18373670.008Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS086F11Sequence622003560 (33)gb:AP004079_18373675e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS122G03Sequence569003560 (33)pir|T05565|T055652e-08hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab
JMFS125F06Sequence580003560 (33)gb:AP004079_18373675e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS125F10Sequence561003560 (33)gb:AP004079_18373674e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS130G07Sequence613003560 (33)gb:AP004079_18373677e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS133C09Sequence626003560 (33)gb:AP004079_18373671e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS135C05Sequence626003560 (33)gb:AP004079_18373676e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS136A10Sequence623003560 (33)gb:AP004079_18373676e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS142C07Sequence641003560 (33)gb:AP004079_18373676e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS157B03Sequence625003560 (33)gb:AP004079_18373676e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS161C12Sequence584003560 (33)gb:AP004079_18373677e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ10
JMFS167G07Sequence613003560 (33)pir|T05565|T055659e-18hypothetical protein F22K18.110 - Arabidopsis thaliana>gb:ATCHRIV62_1546352 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS015H01+ CCAGAT
                      ____________________________________________________________
consensus CCAGAT
 
. : . : . : . : . : . :
JMFF026N17+ TGGTTTAGATAGGATAAGCCTACCTTTGAGAAT
JMFS015H01+ TCATTCTACTCNTGGGTCTCTTGTGGCTGGTTTAGATAGGATAAGCCTACCTTTGAGAAT
                      ____________________________________________________________
consensus TCATTCTACTCNTGGGTCTCTTGTGGCTGGTTTAGATAGGATAAGCCTACCTTTGAGAAT
 
. : . : . : . : . : . :
JMFF026N17+ GCCTCAACGAGCTCAGAAAGGACAGGGGGGGCAGATGATGTAGCTTTAGAAGCCAAGTCG
JMFS015H01+ GCCTCAACGAGCTCAGAAAGGACAGGGGGGGCAGATGATGTAGCTTTAGAAGCCAAGTCG
JMFS167G07+ AGCCAAGTCG
                      ____________________________________________________________
consensus GCCTCAACGAGCTCAGAAAGGACAGGGGGGGCAGATGATGTAGCTTTAGAAGCCAAGTCG
 
. : . : . : . : . : . :
JMFF026N17+ GCAGACAGTTTAATGAGTGTTTCACGCACAGGCTCAGGCACTGCCTTTAAAAGTTCAGAA
JMFS015H01+ GCAGACAGTTTAATGAGTGTTTCACGCACAGGCTCAGGCACTGCCTTTAAAAGTTCAGAA
JMFS167G07+ GCAGACAGTTTAATGAGTGTTTCACGCACAGGCTCAGGCACTGCCTTTAAAAGTTCAGAA
JMFS136A10+ TTAAAAGTTCAGAA
JMFS133C09+ TTTAAAAGTTCAGAA
                      ____________________________________________________________
consensus GCAGACAGTTTAATGAGTGTTTCACGCACAGGCTCAGGCACTGCCTTTAAAAGTTCAGAA
 
. : . : . : . : . : . :
JMFF026N17+ ACACCAGCATTCATGTTCTGAGATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS015H01+ ACACCAGCATTCATGTTCTGAGATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS167G07+ ACACCAGCATTCATGTTCTGAGATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS136A10+ ACACCAGCATTCATGTTCTGAGATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS133C09+ ACACCAGCATTCATGTTCTGAGATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS075E04+ ATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS077F03+ GAGATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS086F11+ TGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS068D10+ TGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS018A08+ GCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS157B03+ TGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS051G10+ CTCAAGGGAGTAGAA
JMFF042M07+ GAGATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
JMFS135C05+ CAAGGGAGTAGAA
JMFS125F06+ CAAGGGAGTAGAA
JMFS072G02+ TCAAGGGAGTAGAA
JMFS142C07+ AAGGGAGTAGAA
                      ____________________________________________________________
consensus ACACCAGCATTCATGTTCTGAGATGTAGGCTGCATGGAAGGAGATCTCAAGGGAGTAGAA
 
. : . : . : . : . : . :
JMFF026N17+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS015H01+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS167G07+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS136A10+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS133C09+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS075E04+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS077F03+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS086F11+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS068D10+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS018A08+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS157B03+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS125F10+ AATTCAGTTTCACTGTAATT
JMFF037E15+ GAATTCAGTTTCACTGTAATT
JMFS077H04+ ATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS051G10+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFF042M07+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS135C05+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS125F06+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFF019D23+ TCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS072G02+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS076A10+ ATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFS142C07+ GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
JMFF006P16+ AATTCAGTTTCACTGTAATT
JMFS037H05+ CAGAATTCAGTTTCACTGTAATT
JMFS130G07+ CTCTCAGAATTCAGTNTCACTGTAATT
                      ____________________________________________________________
consensus GATCCACTGGATCTTGATGAAGGTCTACCACTCCTCTCAGAATTCAGTTTCACTGTAATT
 
. : . : . : . : . : . :
JMFF026N17+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS015H01+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS167G07+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS136A10+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS133C09+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS075E04+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS077F03+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS086F11+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS068D10+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS018A08+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS157B03+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS125F10+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFF037E15+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS077H04+ CTAAGAGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS051G10+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFF042M07+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS135C05+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS125F06+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFF034N09+ CTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFF019D23+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS072G02+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS076A10+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS142C07+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFF021K16+ TCTTCATTATCTCCCAGTGTT
JMFF006P16+ NTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFF030O18+ TCTTCATTATCTCCCAGTGTT
JMFS037H05+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS130G07+ CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
JMFS122G03+ CTCCCAGTGTT
JMFS161C12+ GTGTT
                      ____________________________________________________________
consensus CTAAGGGGATCCAGCTCCTGTTTCACAACATCTTTCAAATCTTCATTATCTCCCAGTGTT
 
. : . : . : . : . : . :
JMFF026N17+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS015H01+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS167G07+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS136A10+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS133C09+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGTCAAGTTG
JMFS075E04+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS077F03+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS086F11+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS068D10+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS018A08+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS157B03+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS125F10+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFF037E15+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS077H04+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS051G10+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFF042M07+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS135C05+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS125F06+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFF034N09+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFF019D23+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS072G02+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS076A10+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS142C07+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFF021K16+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFF006P16+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFF030O18+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGNTG
JMFS037H05+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS130G07+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS122G03+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS161C12+ ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
JMFS085G06+ AGTGATTTGAACATCAGGAGACAAGTTG
                      ____________________________________________________________
consensus ACCACATCATCATCTTCATCAATATAAGTAAGAGTGATTTGAACATCAGGAGACAAGTTG
 
. : . : . : . : . : . :
JMFF026N17+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS015H01+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS167G07+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS136A10+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS133C09+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS075E04+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS077F03+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS086F11+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS068D10+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS018A08+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS157B03+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS125F10+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFF037E15+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS077H04+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS051G10+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFF042M07+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS135C05+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS125F06+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFF034N09+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFF019D23+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS072G02+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS076A10+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS142C07+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFF021K16+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFF006P16+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFF030O18+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTACGTCAAGAGCAAGCTTCTCATCAACA
JMFS037H05+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS130G07+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS122G03+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS161C12+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFF035M19+ TCTATGTCAAGAGCAAGCTTCTCATCAACA
JMFS085G06+ AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
                      ____________________________________________________________
consensus AAGAGATAAAGTATCTTCTCCCTCAGTTGATCTATGTCAAGAGCAAGCTTCTCATCAACA
 
. : . : . : . : . : . :
JMFF026N17+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS015H01+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS167G07+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS136A10+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS133C09+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS075E04+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS077F03+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS086F11+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS068D10+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS018A08+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS157B03+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS125F10+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFF037E15+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS077H04+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS051G10+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFF042M07+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS135C05+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS125F06+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFF034N09+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFF019D23+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS072G02+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS076A10+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS142C07+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFF021K16+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFF006P16+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFF030O18+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS037H05+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS130G07+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS122G03+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS161C12+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFF035M19+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
JMFS085G06+ ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
                      ____________________________________________________________
consensus ACACCAGCATTGAAACGCCGGAGTGTCTCTCCATACTTAACCTTGATGACAATTGAAGTG
 
. : . : . : . : . : . :
JMFF026N17+ TCCATAGCAACGGTCAGCAAGC
JMFS015H01+ TCCATAGCAACGGTCAGCAAGCTTCAGA
JMFS167G07+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTC
JMFS136A10+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS133C09+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS075E04+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS077F03+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS086F11+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS068D10+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS018A08+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS157B03+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS125F10+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF037E15+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS077H04+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS051G10+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF042M07+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS135C05+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS125F06+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF034N09+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF019D23+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF004E11+ TGATTAGATAG
JMFS072G02+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS076A10+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS142C07+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF021K16+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF006P16+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF030O18+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS037H05+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS130G07+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS122G03+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS161C12+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFF035M19+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
JMFS085G06+ TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
                      ____________________________________________________________
consensus TCCATAGCAACGGTCAGCAAGCTTCAGATTACTCCACTAGACTCCACTCTGATTAGATAG
 
. : . : . : . : . : . :
JMFS136A10+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS133C09+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS075E04+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS077F03+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS086F11+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS068D10+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS018A08+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS157B03+ CGTTCCAGGTGAGCCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS125F10+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFF037E15+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS077H04+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS051G10+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFF042M07+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS135C05+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS125F06+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFF034N09+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTGTTTTTTTTAATAAA
JMFF019D23+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTGTTTTTTTTAATAAA
JMFF004E11+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTGTTG-TTTTTTTAATAAA
JMFS072G02+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS076A10+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS142C07+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFF021K16+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFF006P16+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFF030O18+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS037H05+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS130G07+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS122G03+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS161C12+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFF035M19+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
JMFS085G06+ CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
                      ____________________________________________________________
consensus CGTTCCAGGTGAACCGCAAAACAGCAAATATGTAATTTTGTTTTTG-TTTTTTTAATAAA
 
. : . : . : . : . : . :
JMFS136A10+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS133C09+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS075E04+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS077F03+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS086F11+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS068D10+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS018A08+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS157B03+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS125F10+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFF037E15+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS077H04+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS051G10+ TTCGGGATGCAAAGAAACCT
JMFF042M07+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS135C05+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS125F06+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFF034N09+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATCCTTCAACGAGCAAAGCGA
JMFF019D23+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFF004E11+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS072G02+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS076A10+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS142C07+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFF021K16+ TTCGGGATGCAAAGAA----AAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFF006P16+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFF030O18+ TTC-GGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS037H05+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS130G07+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS122G03+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS161C12+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFF035M19+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
JMFS085G06+ TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
                      ____________________________________________________________
consensus TTCGGGATGCAAAGAAACCTAAACCTAGAATTTACAAGAATTCTTCAACGAGCAAAGCGA
 
. : . : . : . : . : . :
JMFS136A10+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS133C09+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS075E04+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS077F03+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS086F11+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS068D10+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS018A08+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS157B03+ TCGAAACGGCGAAGATAGAGCAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS125F10+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF037E15+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS077H04+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF042M07+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS135C05+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS125F06+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF034N09+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF019D23+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF004E11+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS072G02+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS076A10+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS142C07+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF021K16+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF006P16+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF030O18+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS037H05+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS130G07+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS122G03+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS161C12+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFF035M19+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
JMFS085G06+ TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
                      ____________________________________________________________
consensus TCGAAACGGCGAAGATAAAACAGAAATTGAAAGATTTTACCGCAGACCACGCGTAGCCGT
 
. : . : . : . : . : . :
JMFS136A10+ GAGCCGCGCT
JMFS133C09+ GAGCCGCGCTTC
JMFS075E04+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACA
JMFS077F03+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAA
JMFS086F11+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAA
JMFS068D10+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAA
JMFS018A08+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAG
JMFS157B03+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATAC
JMFS125F10+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFF037E15+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS077H04+ GAGCCGCGCTTCTAT
JMFF042M07+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS135C05+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS125F06+ GAGCCGCGCTTCTATCTATACCTAAAAC
JMFF034N09+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFF019D23+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFF004E11+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS072G02+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS076A10+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS142C07+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFF021K16+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFF006P16+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFF030O18+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS037H05+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS130G07+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS122G03+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS161C12+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFF035M19+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
JMFS085G06+ GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
                      ____________________________________________________________
consensus GAGCCGCGCTTCTATCTATACCTAAAACCCTTCTCTCAAATCTCAATACAGACTACTCCG
 
. : . : . : . : . : . :
JMFS125F10+ TA
JMFF037E15+ TATC
JMFF042M07+ TATCAGATAT
JMFS135C05+ TATCATATATACCT
JMFF034N09+ TATCAAATAT
JMFF019D23+ TATCATATAT
JMFF004E11+ TATCAGATAT
JMFS072G02+ TATCATATATACCT
JMFS076A10+ TATCATATATACCTGGTTGTTTGCCGTC
JMFS142C07+ TATCATATATACCTGGTTGTTTGCCGTCTG
JMFF021K16+ TATCATAT
JMFF006P16+ TATCATATAT
JMFF030O18+ TATCATATACACCT
JMFS037H05+ TATCATATATACCTGGTTGTTTGCCGTCTGTT
JMFS130G07+ TATCATATATACCTGGTTGTTTGCCGTCTGTTTATATATATATACAA
JMFS122G03+ TATCATATATACCTGGTTGTTTGCCGTCTGTTTATATATATATACAATGAAACTTATATT
JMFS161C12+ TATCATATATACCTGGTTGTTTGCCGTCTGTTTATATATATATACAATGAAACTTATATT
JMFF035M19+ TATCATATATACCTGGTTGTTTGCCGTCTGTTTATATATATATACAATGAAACTTATATT
JMFS085G06+ TATCATATATACCTGGTTGTTTGCCGTCTGTTTATATATATATACAATGAAACTTATATT
                      ____________________________________________________________
consensus TATCATATATACCTGGTTGTTTGCCGTCTGTTTATATATATATACAATGAAACTTATATT
 
. : . : . : . : . : . :
JMFS122G03+ ATTGTTGTTGTTGCGAATT
JMFS161C12+ ATTGTTGTTGTTGCGAATTTCTTGGTCCCAAAGATAACCA
JMFF035M19+ ATTGTTGTTGTTGCGAATTTCTTGGTCCCAAAGATAACCACTGCGCTAAGTAATGAAAAA
JMFS085G06+ ATTGTTGTTGTTGCGAATTTCTTGGTCCCAAAGATAACCACTGCGCTAAGTAATGAAAAA
                      ____________________________________________________________
consensus ATTGTTGTTGTTGCGAATTTCTTGGTCCCAAAGATAACCACTGCGCTAAGTAATGAAAAA
 
. : . : . : . : . : . :
JMFF035M19+ GTCTATCAAGTCTATCC
JMFS085G06+ GTCTATCAAGTCTATCCAAGAAATCATCCTGTGTAGGTCAGAACATCTTAATCGATATGG
                      ____________________________________________________________
consensus GTCTATCAAGTCTATCCAAGAAATCATCCTGTGTAGGTCAGAACATCTTAATCGATATGG