Previous Contig 003558:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004E24Sequence271003558 (6)606008321 (3)gb:AY283056_15947214e-30Gossypium hirsutum central motor kinesin 1 (CMK1) mRNA, complete cds.
JMFF042H23Sequence613003558 (6)gb:AB022217_15150661e-23Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6.
JMFS013B01Sequence621003558 (6)gb:AB022217_15150665e-29Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6.
JMFS085E06Sequence625003558 (6)gb:AB022217_15150661e-23Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6.
JMFS104G08Sequence622003558 (6)gb:AB022217_15150661e-32Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6.
JMSF025P03Sequence630003558 (6)gb:AB022217_15150663e-27Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6.742008321 (3)gb:AY056129_15634659e-38Arabidopsis thaliana putative kinesin protein (At3g16630) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025P03+ GGAGAATAAAGTC
                      ____________________________________________________________
consensus GGAGAATAAAGTC
 
. : . : . : . : . : . :
JMFS104G08+ CCTGAATTTTGGGCAGTTGGGGTATATGGTTCAGAACCAG
JMSF025P03+ CTTCTGATACAGGAATACCTCCTGAATTTTGGGCAGTTGGGGTATATGGTT-AGAACCAG
JMFS013B01+ TTTGGGCAGTTGGGGTATATGGTTCAGAACCAG
                      ____________________________________________________________
consensus CTTCTGATACAGGAATACCTCCTGAATTTTGGGCAGTTGGGGTATATGGTTCAGAACCAG
 
. : . : . : . : . : . :
JMFS104G08+ ATTCACCATTAAAATTGAGGTTTCTCATTAATCTTAAAAGCCTTTGTTTCTCTTCTACAG
JMSF025P03+ ATTCACCATTAAAATTGAGGTTTCTCATTAATCTTAAAAGCCTTTGTTTCTCTTCTACAG
JMFS013B01+ ATTCACCATTANAATTGAGGTTTCTCATTAATCTTAAAAGCCTTTGTTTCTCTTCTACAG
JMFF042H23+ TGAGGTTTCTCATTAATCTTAAAAGCCTTTG-TTCTCTTCTACAG
JMFS085E06+ TAAAAGCCTTTG-TTCTCTTCTACAG
                      ____________________________________________________________
consensus ATTCACCATTAAAATTGAGGTTTCTCATTAATCTTAAAAGCCTTTGTTTCTCTTCTACAG
 
. : . : . : . : . : . :
JMFS104G08+ ACTGTGCTCCATACCCCTGCATAAGGATGTTGGGAAGTAGGCGGTTATCGACACCAGTGG
JMSF025P03+ ACTGTGCTCCATACCCCTGCATAAGGATGTTGGGAAGTAGGCGGTTATCGACACCAGTGG
JMFS013B01+ ACTGTGCTCCATACCCCTGCATAAGGATGTTGGGAAGTAGGCGGTTATCGACACCAGTGG
JMFF042H23+ ACTGTGCTCCATACCCCTGCATAAGGATGTTGGGAAGTAGGCGGTTATCGACACCAGTGG
JMFS085E06+ ACTGTGCTCCATACCCCTGCATAAGGATGTTGGGAAGTAGGCGGTTATCGACACCAGTGG
                      ____________________________________________________________
consensus ACTGTGCTCCATACCCCTGCATAAGGATGTTGGGAAGTAGGCGGTTATCGACACCAGTGG
 
. : . : . : . : . : . :
JMFS104G08+ AGGCCAAAGGAGAGGCCAGATGCTGCAACCCGGCAGACTGAAGCCAGCGCGCCATGACAG
JMSF025P03+ AGGCCAAAGGAGAGGCCAGATGCTGCAACCCGGCAGACTGAAGCCAGCGCGCCATGACAG
JMFS013B01+ AGGCCAAAGGAGAGGCCAGATGCTGCAACCCGGCAGACTGAAGCCAGCGCGCCATGACAG
JMFF042H23+ AGGCCAAAGGAGAGGCCAGATGCTGCAACCCGGCAGACTGAAGCCAGCGCGCCATGACAG
JMFS085E06+ AGGCCAAAGGAGAGGCCAGATGCTGCAACCCGGCAGACTGAAGCCAGCGCGCCATGACAG
                      ____________________________________________________________
consensus AGGCCAAAGGAGAGGCCAGATGCTGCAACCCGGCAGACTGAAGCCAGCGCGCCATGACAG
 
. : . : . : . : . : . :
JMFS104G08+ CGTCTCCCGCATCGCCCGCGGGGCCGGCATTGCCTTGGTGATCATACAGAGCAGTCGCCG
JMSF025P03+ CGTCTCCCGCATCGCCCGCGGGGCCGGCATTGCCTTGGTGATCATACAGAGCAGTCGCCG
JMFS013B01+ CGTCTCCCGCATCGCCCGCGGGGCCGGCATTGCCTTGGTGATCATACAGAGCAGTCGCCG
JMFF042H23+ CGTCTCCCGCATCGCCCGCGGGGCCGGCATTGCCTTGGTGATCATACAGAGCAGTCGCCG
JMFS085E06+ CGTCTCCCGCATCGCCCGCGGGGCCGGCATTGCCTTGGTGATCATACAGAGCAGTCGCCG
                      ____________________________________________________________
consensus CGTCTCCCGCATCGCCCGCGGGGCCGGCATTGCCTTGGTGATCATACAGAGCAGTCGCCG
 
. : . : . : . : . : . :
JMFS104G08+ CCGAATTGCTCTGCTGCATCTGGCCACCCATGTGGCGCTGCGACCGGCGTTGGGGAGCCA
JMSF025P03+ CCGAATTGCTCTGCTGCATCTGGCCACCCATGTGGCGCTGCGACCGGCGTTGGGGAGCCA
JMFS013B01+ CCGAATTGCTCTGCTGCATCTGGCCACCCATGTGGCGCTGCGACCGGCGTTGGGGAGCCA
JMFF042H23+ CGGAATTGCTCTGCTGCATCTGGCCACCCATGTGGCGCTGCGACCGGCGTTGGGGAGCCA
JMFS085E06+ CCGAATTGCTCTGCTGCATCTGGCCACCCATGTGGCGCTGCGACCGGCGTTGGGGAGCCA
                      ____________________________________________________________
consensus CCGAATTGCTCTGCTGCATCTGGCCACCCATGTGGCGCTGCGACCGGCGTTGGGGAGCCA
 
. : . : . : . : . : . :
JMFS104G08+ ATTTCAAGATCTGTTATTCCAAGGGGGCGGCGAAAATCGAAATCAAATCCACGCATTCAC
JMSF025P03+ ATTTCAAGATCTGTTATTCCAAGGGGGCGGCGAAAATCGAAATCAAATCCACGCATTCAC
JMFS013B01+ ATTTCAAGATCTGTTATTCCAAGGGGGCGGCGAAAATCGAAATCAAATCCACGCATTCAC
JMFF004E24+ CAAATCCACGCATTCAC
JMFF042H23+ ATTTCAAGATCTGTTATTCCAAGGGGGCGGCGAAAATCGAAATCAAATCCACGCATTCAC
JMFS085E06+ ATTTCAAGATCTGTTATTCCAAGGGGGCGGCGAAAATCGAAATCAAATCCACGCATTCAC
                      ____________________________________________________________
consensus ATTTCAAGATCTGTTATTCCAAGGGGGCGGCGAAAATCGAAATCAAATCCACGCATTCAC
 
. : . : . : . : . : . :
JMFS104G08+ GCGCGAATTCAATCCAACTCAATTGAATCCGGAAACCAATAAATCCCGATCGCAATCCCC
JMSF025P03+ GCGCGAATTCAATCCAACTCAATTGAATCCGGAAACCAATAAATCCCGATCGCAATCCCC
JMFS013B01+ GCGCGAATTCAATCCAACTCAATTGAATCCGGAAACCAATAAATCCCGATCGCAATCCCC
JMFF004E24+ GCGCGAATTCAATCCAACTCAATTGAATCCGGAAACCAATAAATCCCGATCGCAATCCCC
JMFF042H23+ GCGCGAATTCAATCCAACTCAATTGAATCCGGAAACCAATAAATCCCGATCGCAATCCCC
JMFS085E06+ GCGCGAATTCAATCCAACTCAATTGAATCCGGAAACCAATAAATCCCGATCGCAATCCCC
                      ____________________________________________________________
consensus GCGCGAATTCAATCCAACTCAATTGAATCCGGAAACCAATAAATCCCGATCGCAATCCCC
 
. : . : . : . : . : . :
JMFS104G08+ GAAATGAACCGCAAAAACATCAAATATTCATTCAGAATTGAATTGAATCCAGTCTTCGGA
JMSF025P03+ GAAATGAACCGCAAAAACATCAAATATTCATTCAGAATTGAATTGAATCCAGTCTTCGGA
JMFS013B01+ GAAATGAACCGCAAAAACATCAAATATTCATTCAGAATTGAATTGAATCCAGTCTTCGGA
JMFF004E24+ GAAATGAACCGCAAAAACATCAAATATTCATTCAGAATTGAATTGAATCCAGTCTTCGGA
JMFF042H23+ GAAATGAACCGCAAAAACATCAAATATTCATTCAGAATTGAATTGAATCCAGTCTTCGGA
JMFS085E06+ GAAATGAACCGCAAAAACATCAAATATTCATTCAGAATTGAATTGAATCCAGTCTTCGGA
                      ____________________________________________________________
consensus GAAATGAACCGCAAAAACATCAAATATTCATTCAGAATTGAATTGAATCCAGTCTTCGGA
 
. : . : . : . : . : . :
JMFS104G08+ GACAGATCAGACGGGTAAATGAGAAAGCAAAACCCTAATTTATTGAAAGAATTTCCCCCA
JMSF025P03+ GACAGATCAGACGGGTAAATGAGAAAGCAAAACCCTAATTTATTGAAAGAATTTCCCCCA
JMFS013B01+ GACAGATCAGACGGGTAAATGAGAAAGCAAAACCCTAATTTATTGAAAGAATTTCCCCCA
JMFF004E24+ GACAGATCAGACGGGTAAATGAGAAAGCAAAACCCTAATTTATTGAAAGAATTTCCCCCA
JMFF042H23+ GACAGATCAGACGGGTAAATGAGAAAGCAAAACCCTAATTTATTGAAAGAATTTCCCCCA
JMFS085E06+ GACAGATCAGACGGGTAAATGAGAAAGCAAAACCCTAATTTATTGAAAGAATTTCCCCCA
                      ____________________________________________________________
consensus GACAGATCAGACGGGTAAATGAGAAAGCAAAACCCTAATTTATTGAAAGAATTTCCCCCA
 
. : . : . : . : . : . :
JMFS104G08+ AAAAACTGTT
JMSF025P03+ AAAAACTGTTAAAAACT
JMFS013B01+ AAAAACTGTTAAAAACTAATGGAATTGTTGTGGATGAGAAGATGAA
JMFF004E24+ AAAAACTGTTAAAAACTAATGGAATTGTTGTGGATGAGAAGATGAAGATAATGGAGGGAG
JMFF042H23+ AAAAACTGTTAAAAACTAATGGAATTGTTGTGGATGAGAAGATGAAGATAATGGAGGGAG
JMFS085E06+ AAAAACTGTTAAAAACTAATGGAATTGTTGTGGATGAGAAGATGAAGATAATGGAGGGAG
                      ____________________________________________________________
consensus AAAAACTGTTAAAAACTAATGGAATTGTTGTGGATGAGAAGATGAAGATAATGGAGGGAG
 
. : . : . : . : . : . :
JMFF004E24+ TAATTTTAACCTTC
JMFF042H23+ TAATTTTAACCTTCTCCTGACAGAC
JMFS085E06+ TAATTTTAACCTTCTCCTGACAGACAAATTGTATCTGTATCTATAGGTGGTGAATACAAA
                      ____________________________________________________________
consensus TAATTTTAACCTTCTCCTGACAGACAAATTGTATCTGTATCTATAGGTGGTGAATACAAA