Previous Contig 003556:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS016G05Sequence514003556 (8)
JMFS072E06Sequence621003556 (8)gb:AY054668_15633222e-07Arabidopsis thaliana putative protein (At4g37590; F19F18.80) mRNA, complete cds.
JMFS085B03Sequence617003556 (8)
JMFS143G10Sequence626003556 (8)
JMFS159B10Sequence512003556 (8)
JMFS165F09Sequence589003556 (8)
JMSF026G08Sequence279003556 (8)731003556 (8)gb:AY150514_15850794e-22Arabidopsis thaliana unknown protein (At4g31820) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF026G08+ TCA
                      ____________________________________________________________
consensus TCA
 
. : . : . : . : . : . :
rJMSF026G08+ GTCATCTCAAGATACTCCGCAGCACAACGAGCCGCAACAACGTNGTAGGGATTAAGAGTC
                      ____________________________________________________________
consensus GTCATCTCAAGATACTCCGCAGCACAACGAGCCGCAACAACGTNGTAGGGATTAAGAGTC
 
. : . : . : . : . : . :
rJMSF026G08+ ACCGTAATTCCATAGCAGAATTTGGCACATATCTCAAATGTCTTCGGTCCACCGGGAAAA
                      ____________________________________________________________
consensus ACCGTAATTCCATAGCAGAATTTGGCACATATCTCAAATGTCTTCGGTCCACCGGGAAAA
 
. : . : . : . : . : . :
rJMSF026G08+ TCAACCAGCTGAATTTCGTCAGAACTCTGCTCGCTCTCTCTCGACAGAAGCTTTTGCAAT
                      ____________________________________________________________
consensus TCAACCAGCTGAATTTCGTCAGAACTCTGCTCGCTCTCTCTCGACAGAAGCTTTTGCAAT
 
. : . : . : . : . : . :
rJMSF026G08+ CGATTGGACTTGGACAAGAGAGGGAACTGCAAAAGTAAAGCGTGACAACTATACTGTNCG
                      ____________________________________________________________
consensus CGATTGGACTTGGACAAGAGAGGGAACTGCAAAAGTAAAGCGTGACAACTATACTGTNCG
 
. : . : . : . : . : . :
rJMSF026G08+ ANCGATATAANCGATNCAACATNCCACTTCAGAATGAGGTGACCCAAAAAAGAATCAATA
                      ____________________________________________________________
consensus ANCGATATAANCGATNCAACATNCCACTTCAGAATGAGGTGACCCAAAAAAGAATCAATA
 
. : . : . : . : . : . :
rJMSF026G08+ GTTATACTTATCACCCCCAAAAAAATATGGAGGAAAACCGAGAAATGATTGNCAGAAAAT
                      ____________________________________________________________
consensus GTTATACTTATCACCCCCAAAAAAATATGGAGGAAAACCGAGAAATGATTGNCAGAAAAT
 
. : . : . : . : . : . :
rJMSF026G08+ TACCTTGTGAAGATAAAATTTCACTTCTCCGACAACAATGGTAACGTCTGTTGNTAATTC
JMFS072E06+ CAACAATGGTAACGTCTGTTGCTAATTC
                      ____________________________________________________________
consensus TACCTTGTGAAGATAAAATTTCACTTCTCCGACAACAATGGTAACGTCTGTTGCTAATTC
 
. : . : . : . : . : . :
rJMSF026G08+ AGATGACACGTACCTAATGAAGTTGCCATCAGATTGGAATGCATCAGGCTTTGACCCCAG
JMFS072E06+ AGATGACACGTACCTAATGAAGTTGCCATCAGATTGGAATGCATCAGGCTTTGACCCCAG
JMFS165F09+ GGAATGCATCAGGCTTTGACCCCAG
                      ____________________________________________________________
consensus AGATGACACGTACCTAATGAAGTTGCCATCAGATTGGAATGCATCAGGCTTTGACCCCAG
 
. : . : . : . : . : . :
rJMSF026G08+ CTTCATAAACTTCATTTTCTTCCAAATTTNCCGACCAAACTCTCATTAAATTATGGCCCA
JMFS072E06+ CTTCATAAACTTCATTTTCTTCCAAATTTACCGACCAAACTCTCACTAAATTATGGCCCA
JMFS165F09+ CTTCATAAACTTCATTTTCTTCCAAATTTACCGACCAAACTCTCACTAAATTATGGCCCA
                      ____________________________________________________________
consensus CTTCATAAACTTCATTTTCTTCCAAATTTACCGACCAAACTCTCACTAAATTATGGCCCA
 
. : . : . : . : . : . :
rJMSF026G08+ AGATTTACCGCTTCACTTTCAGCAGCACCCAAAACTAACTATTGTATATATATCTCTCTC
JMFS072E06+ AGATTTACCGCTTCACTTTCAGCAGCACCCAAAACTAACTATTGTATATATATCTCTCTC
JMFS165F09+ AGATTTACCGCTTCACTTTCAGCAGCACCCAAAACTAACTATTG--TATATATCTCTCTC
JMFS143G10+ AAAACTAACTATTGTATATATATCTCTCTC
JMFS085B03+ ATTGTATATATATCTCTCTC
                      ____________________________________________________________
consensus AGATTTACCGCTTCACTTTCAGCAGCACCCAAAACTAACTATTGTATATATATCTCTCTC
 
. : . : . : . : . : . :
rJMSF026G08+ TCCTCCTAGGAAGAAGAGCATGAGCAGCGAAGAGGCATATTCACGGACTNCAATACAAGC
JMFS072E06+ TCCTCCTAGGAAGAAGAGCATGAGCAGCGAAGAGGCATATTCA-GGACTCCAATACAAGC
JMFS165F09+ TCCTCCTAGGAAGAAGAGCATGAGCAGCGAAGAGGCATATTCA-GGACTCCAATACAAGC
JMFS143G10+ TCCTC--AGGAAGAAGAGCATGAGCAGCGAAGAGGCATATTCA-GGACTCCAATACAAGC
JMFS085B03+ TCCTCCTAGGAAGAAGAGCATGAGCAGCGAAGAGGCATATTCA-GGACTCCAATACAAGC
                      ____________________________________________________________
consensus TCCTCCTAGGAAGAAGAGCATGAGCAGCGAAGAGGCATATTCA-GGACTCCAATACAAGC
 
. : . : . : . : . : . :
rJMSF026G08+ AGAAACAAACAAGTCACTAACCCANGAAGAAGAAGAAGCAAGAATAAAGACAATGGCATA
JMFS072E06+ AGAAACAAACAAGTCACTAACCCAAGAAGAAGAAGAAGCAAGAATAAAGACAATGGCATA
JMFS165F09+ AGAAACAAACAAGTCACTAACCCAAGAAGAAGAAGAAGCAAGAATAAAGACAATGGCATA
JMFS143G10+ AGAAACAAACAAGTCACTAACCCAAGAAGAAGAAGAAGCAAGAATAAAGCCAATGGCATA
JMFS085B03+ AGAAACAAACAAGTCACTAACCCAAGAAGAAGAAGAAGCAAGAATAAAGNCAATGGCATA
                      ____________________________________________________________
consensus AGAAACAAACAAGTCACTAACCCAAGAAGAAGAAGAAGCAAGAATAAAGACAATGGCATA
 
. : . : . : . : . : . :
rJMSF026G08+ ATCT
JMFS072E06+ ATCTTGTTCTTCCCAACAACCTCGACCCACGAGCCACCACCACATTACAAAAAAAAAAAA
JMFS165F09+ ATCTTGTTCTTCCCAACAACCTCGACCCACGAGCCACCACCACATTAC-AAAAAAAAAAA
JMFS143G10+ ATCTTGTTCTTCCCAACAACCTCGACCCACGAGCCACCACCACATTACAAAAAAAAAAAA
JMSF026G08+ AAAAAAAAAAA
JMFS085B03+ ATCTTGTTCTTCCCAACAACCTCGACCCACGAGCCACCACCACATTAC-AAAAAAAAAAA
                      ____________________________________________________________
consensus ATCTTGTTCTTCCCAACAACCTCGACCCACGAGCCACCACCACATTACAAAAAAAAAAAA
 
. : . : . : . : . : . :
JMFS072E06+ AAAAAAAGAACTTTTTTCTTCTTGGTTGCTTTTCCGAATCACATTGATGACGAAGATGAC
JMFS165F09+ AAAAAAAGAACTTTTTTCTTCTTGGTTGCTTTTCCGAATCACATTGATGACGAAGATGAC
JMFS143G10+ AAAAAAAGAACTTTTTTCTTCTTGGTTGCTTTTCCGAATCACATTGATGACGAAGATGAC
JMFS016G05+ GAACTTTTTTCTTCTTGGTTGCTTTTCCGAATCACATTGATGACGAAGATGAC
JMFS159B10+ GAACTTTTTTCTTCTTGGTTGCTTTTCCGAATCACATTGATGACGAAGATGAC
JMSF026G08+ AAAAAAAGAACTTTTTTCTTCTTGGTTGCTTTTCCGAATCACATTGATGACGAAGATGAC
JMFS085B03+ AAAAAAAGAACTTTTTTCTTCTTGGTTGCTTTTCCGAATCACATTGATGACGAAGATGAC
                      ____________________________________________________________
consensus AAAAAAAGAACTTTTTTCTTCTTGGTTGCTTTTCCGAATCACATTGATGACGAAGATGAC
 
. : . : . : . : . : . :
JMFS072E06+ GGAATTGGGCTATGATACGACCAACCCACTACGCATAATTGAATGGGGTTATTAAATTGT
JMFS165F09+ GGAATTGGGCTATGATACGACCAACCCACTACGCATAATTGAATGGGGTTATTAAATTGT
JMFS143G10+ GGAATTGGGCTATGATACGACCAACCCACTACGCATAATTGAATGGGGTTATTAAATTGT
JMFS016G05+ GGAATTGGGCTATGATACGACCAACCCACTACGCATAATTGAATGGGGTTATTAAATTGT
JMFS159B10+ GGAATTGGGCTATGATACGACCAACCCACTACGCATAATTGAATGGGGTTATTAAATTGT
JMSF026G08+ GGAATTGGGCTATGATACGACCAACCCACTACGCATAATTGAATGGGGTTATTAAATTGT
JMFS085B03+ GGAATTGGGCTATGATACGACCAACCCACTACGCATAATTGAATGGGGTTATTAAATTGT
                      ____________________________________________________________
consensus GGAATTGGGCTATGATACGACCAACCCACTACGCATAATTGAATGGGGTTATTAAATTGT
 
. : . : . : . : . : . :
JMFS072E06+ TGAGTAGCCTAGCCGCCTTTGAAATAGTAACCTTCAGAGCTGATGAGAATCATGAGATGA
JMFS165F09+ TGAGTAGCCTAGCCGCCTTTGAAATAGTAACCTTCAGAGCTGATGAGAATCATGAGATGA
JMFS143G10+ TGAGTAGCCTAGCCGCCTTTGAAATAGTAACCTTCAGAGCTGATGAGAATCATGAGATGA
JMFS016G05+ TGAGTAGCCTAGCCGCCTTTGAAATAGTAACCTTCAGAGCTGATGAGAATCATGAGATGA
JMFS159B10+ TGAGTAGCCTAGCCGCCTTTGAAATAGTAACCTTCAGAGCTGATGAGAATCATGAGATGA
JMSF026G08+ TGAGTAGCCTAGCCGCCTTTGAAATAGTAACCTTCAGAGCTGATGAGAATCATGAGATGA
JMFS085B03+ TGAGTAGCCTAGCCGCCTTTGAAATAGTAACCTTCAGAGCTGATGAGAATCATGAGATGA
                      ____________________________________________________________
consensus TGAGTAGCCTAGCCGCCTTTGAAATAGTAACCTTCAGAGCTGATGAGAATCATGAGATGA
 
. : . : . : . : . : . :
JMFS072E06+ TTCTTTGTAAGATGTAATGATCTCTCCTTCGCTCGCAAATCTCAAAGATCTTTC
JMFS165F09+ TTCTTTGTAAGATGTAATGATCTCTCCTTCGCTCGCAAATCTCAAAGATCTTTC-TTTTT
JMFS143G10+ TTCTTTGTAAGATGTAATGATCTCTCCTTCGCTCGCAAATCTCAAAGATCTTTC-TTTTT
JMFS016G05+ TTCTTTGTAAGATGTAATGATCTCTCCTTCGCTCGCAAATCTCAAAGATCTTTC-TTTTT
JMFS159B10+ TTCTTTGTAAGATGTAATGATCTCTCCTTCGCTCGCAAATCTCAAAGATCTTTCTTTTTT
JMSF026G08+ TTCTTTGTAAGATGTAATGATCTCTCCTTCGCTCGCAAATCTCAAAGATCTTTC-TTTTT
JMFS085B03+ TTCTTTGTAAGATGTAATGATCTCTCCTTCGCTCGCAAATCTCAAAGATCTTTC-TTTTT
                      ____________________________________________________________
consensus TTCTTTGTAAGATGTAATGATCTCTCCTTCGCTCGCAAATCTCAAAGATCTTTC-TTTTT
 
. : . : . : . : . : . :
JMFS165F09+ TCTTTCTCTCTCTGCGGGTGTAGATACAG
JMFS143G10+ TCTTTCTCTCTCTGCGGGTGTAGATACAGGTGAAACATATATGTATGTGTACACGCTCTG
JMFS016G05+ TCTTTCTCTCTCTGCGGGTGTAGATACAGGTGAAACATATATGTATGTGTACACGCTCTG
JMFS159B10+ TCTTTCTCTCTCTGCGGGTGTAGATACAGGTGAAACATATATGTATGTGTACACGCTCTG
JMSF026G08+ TCT
JMFS085B03+ TCTTTCTCTCTCTGCGGGTGTAGATACAGGTGAAACATATATGTATGTGTACACGCTCTG
                      ____________________________________________________________
consensus TCTTTCTCTCTCTGCGGGTGTAGATACAGGTGAAACATATATGTATGTGTACACGCTCTG
 
. : . : . : . : . : . :
JMFS143G10+ AGTGCACTGATGAGGTTGTCGCTCTAGTCTCTGAAACTTTGCAGGTAAAGATGTAATAGG
JMFS016G05+ AGTGCACTGATGAGGTTGTCGCTCTAGTCTCTGAAACTTTGCAGGTAAAGATGTAATAGG
JMFS159B10+ AGTGCACTGATGAGGTTGTCGCTCTAGTCTCTGAAACTTTGCAGGTAAAGATGTAATAGG
JMFS085B03+ AGTGCACTGATGAGGTTGTCGCTCTAGTCTCTGAAACTTTGCAGGTAAAGATGTAATAGG
                      ____________________________________________________________
consensus AGTGCACTGATGAGGTTGTCGCTCTAGTCTCTGAAACTTTGCAGGTAAAGATGTAATAGG
 
. : . : . : . : . : . :
JMFS143G10+ AGAGAGAAAATGTCAGTAAAGAGAGAGAGAGAGAGGGGAATGGAGTAGTAGGGGACTGTG
JMFS016G05+ AGAGAGAAAATGTCAGTAAAGAGAGAGAGAGAGA
JMFS159B10+ AGAGAGAAAACGTCAGTAAAGAGAGAGAGAGAGA
JMFS085B03+ AGAGAGAAAATGTCAGTAAAGAGAGAGAGAGAGAGGGGAATGGAGTAGTAGGGGACTGTG
                      ____________________________________________________________
consensus AGAGAGAAAATGTCAGTAAAGAGAGAGAGAGAGAGGGGAATGGAGTAGTAGGGGACTGTG