Previous Contig 003554:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043J16Sequence640003554 (5)gb:AY448010S4_16065883e-77Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.599010330 (2)gb:AY448010S4_16065883e-17Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.
JMFS025B01Sequence636003554 (5)gb:AY448010S4_16065884e-92Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.
JMFS051A05Sequence588003554 (5)gb:AY448010S4_16065888e-60Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.
JMFS084F05Sequence624003554 (5)gb:AY448010S4_16065888e-64Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.
JMFS134H03Sequence614003554 (5)gb:AY448010S4_16065881e-65Ipomoea trifida haplotype S1 self-incompatibility (S-) locus, contig SR4.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS025B01+ GACGTAGGAGACACAATGCAGCTTTCTTCCTGACAAGTGGCCGGCAGCTACT
JMFF043J16+ GCCGGCAGCTACT
                      ____________________________________________________________
consensus GACGTAGGAGACACAATGCAGCTTTCTTCCTGACAAGTGGCCGGCAGCTACT
 
. : . : . : . : . : . :
JMFS025B01+ TGAAATTAGTAGCTTTTGCACAT-CAGGTGCTAGAGATTCAGCAAATTCCCTTCCACCTA
JMFF043J16+ TGAAATTAGTAGC-TTTGCACATCCAGGTGCTAGAGATTCAGCAAATTCCCTTCCACCTA
                      ____________________________________________________________
consensus TGAAATTAGTAGCTTTTGCACATCCAGGTGCTAGAGATTCAGCAAATTCCCTTCCACCTA
 
. : . : . : . : . : . :
JMFS025B01+ TATTTCCAACCAAAGTTAAAGCTAGGCACTGAAAAGTCTCATTGCGGCCAATTATGTCAT
JMFF043J16+ TATTTCCAACCAAAGTTAAAGCTAGGCACTGAAAAGTCTCATTGCGGCCAATTATGTCAT
JMFS134H03+ CACTGAAAAGTCTCATTGCGGCAAATTATGTCAT
JMFS051A05+ CCAATTATGTCAT
JMFS084F05+ GTCTCATTGCGGCCAATTATGTCAT
                      ____________________________________________________________
consensus TATTTCCAACCAAAGTTAAAGCTAGGCACTGAAAAGTCTCATTGCGGCCAATTATGTCAT
 
. : . : . : . : . : . :
JMFS025B01+ TCCGCACAGCATTGATTGCTAATCTCAAGAAATCATGATTCTCATTCAGCAAACAAGAAG
JMFF043J16+ TCCGCACAGCATTGATTGCTAATCTCAAGAAATCATGATTCTCATTCAGCAAACAAGAAG
JMFS134H03+ TCCGCACAGCATTGATTGCTAATCTCAAGAAATCATGATTCTCATTCAGCAAACAAGAAG
JMFS051A05+ TCCGCACAGCATTGATTGCTAATCTCAAGAAATCATGATTCTCATTCAGCAAACAAGAAG
JMFS084F05+ TCCGCACAGCATTGATTGCTAATCTCAAGAAATCATGATTCTCATTCAGCAAACAAGAAG
                      ____________________________________________________________
consensus TCCGCACAGCATTGATTGCTAATCTCAAGAAATCATGATTCTCATTCAGCAAACAAGAAG
 
. : . : . : . : . : . :
JMFS025B01+ TGACTATGTAACCAACCTGCTTCTCGGGATACTTTGGAGCAGATATCAAAGAAACTGCTT
JMFF043J16+ TGACTATGTAACCAACCTGCTTCTCGGGATACTTTGGAGCAGATATCAAAGAAACTGCTT
JMFS134H03+ TGACTATGTAACCAACCTGCTTCTCGGGATACTTTGGAGCAGATATCAAAGAAACTGCTT
JMFS051A05+ TGACTATGTAACCAACCTGCTTCTCGGGATACTTTGGAGCAGATATCAAAGAAACTGCTT
JMFS084F05+ TGACTATGTAACCAACCTGCTTCTCGGGATACTTTGGAGCAGATATCAAAGAAACTGCTT
                      ____________________________________________________________
consensus TGACTATGTAACCAACCTGCTTCTCGGGATACTTTGGAGCAGATATCAAAGAAACTGCTT
 
. : . : . : . : . : . :
JMFS025B01+ CCATGTGACCAAAATCCACATCATAACCAAGCATATAAATGTAAAGCATCTTCCAAACAT
JMFF043J16+ CCATGTGACCAAAATCCACATCATAACCAAGCATATAAATGTAAAGCATCTTCCAAACAT
JMFS134H03+ CCATGTGACCAAAATCCACATCATAACCAAGCATATAAATGTAAAGCATCTTCCAAACAT
JMFS051A05+ CCATGTGACCAAAATCCACATCATAACCAAGCATATAAATGTAAAGCATCTTCCAAACAT
JMFS084F05+ CCATGTGACCAAAATCCACATCATAACCAAGCATATAAATGTAAAGCATCTTCCAAACAT
                      ____________________________________________________________
consensus CCATGTGACCAAAATCCACATCATAACCAAGCATATAAATGTAAAGCATCTTCCAAACAT
 
. : . : . : . : . : . :
JMFS025B01+ ATTTCTTCTTCTCATAATGAGTCAAGCCCTTTTCGTTCTTGAAGCGAGTACGGACGTTGC
JMFF043J16+ ATTTCTTCTTCTCATAATGAGTCAAGCCCTTTTCGTTCTTGAAGCGAGTACGGACGTTGC
JMFS134H03+ ATTTCTTCTTCTCATAATGAGTCAAGCCCTTTTCGTTCTTGAAGCGAGTACGGACGTTGC
JMFS051A05+ ATTTCTTCTTCTCATAATGAGTCAAGCCCTTTTCGTTCTTGAAGCGAGTACGGACGTTGC
JMFS084F05+ ATTTCTTCTTCTCATAATGAGTCAAGCCCTTTTCGTTCTTGAAGCGAGTACGGACGTTGC
                      ____________________________________________________________
consensus ATTTCTTCTTCTCATAATGAGTCAAGCCCTTTTCGTTCTTGAAGCGAGTACGGACGTTGC
 
. : . : . : . : . : . :
JMFS025B01+ CCAGCTCCTTGTCGACGCGGAGGCGCTCCTGCTCTTTGTTCTGGCAATTGCGAATATCGC
JMFF043J16+ CCAGCTCCTTGTCGACGCGGAGGCGCTCCTGCTCTTTGTTCTGGCAATTGCGA--ATCGC
JMFS134H03+ CCAGCTCCTTGTCGACGCGGAGGCGCTCCTGCTCTTTGTTCTGGCAATTGCGAATATCGC
JMFS051A05+ CCAGCTCCTTGTCGACGCGGAGGCGCTCCTGCTCTTTGTTCTGGCAATTGCGAATATCGC
JMFS084F05+ CCAGCTCCTTGTCGACGCGGAGGCGCTCCTGCTCTTTGTTCTGGCAATTGCGAATATCGC
                      ____________________________________________________________
consensus CCAGCTCCTTGTCGACGCGGAGGCGCTCCTGCTCTTTGTTCTGGCAATTGCGAATATCGC
 
. : . : . : . : . : . :
JMFS025B01+ TTATAAATACCGATAGACCTCTCATTCCAGAC-AACGCCATGTCCTTCGAAACTCAGATC
JMFF043J16+ TTATAAATACCGATAGACCTCTCATTCCAGAC-AACGCCATGTCCTTCGAAACTCAGATC
JMFS134H03+ TTATAAATACCGATAGACCTCTCATTCCAGAC-AACGCCATGTCCTTCGAAACTCAGATC
JMFS051A05+ TTATAAATACCGATAGACCTCTCATTCCAGACTAACGCCATGTCCTTCGAAACTCAGATC
JMFS084F05+ TTATAAATACCGATAGACCTCTCATTCCAGAC-AACGCCATGTCCTTCGAAACTCAGATC
                      ____________________________________________________________
consensus TTATAAATACCGATAGACCTCTCATTCCAGAC-AACGCCATGTCCTTCGAAACTCAGATC
 
. : . : . : . : . : . :
JMFS025B01+ CGATCCAGCGGATAAACCTCAACTTCTATCTAGATTCTAGCCCTTGAAATTCTCTCGATC
JMFF043J16+ CGATCCAGCGGATAAACCTCAACTTCTATCTAGATTCTAGCCCTTGAAATTCTCTCGATC
JMFS134H03+ CGATCCAGCGGATAAACCTCAACTTCTATCTAGATTCTAGCCCTTGAAATTCTCTCGATC
JMFS051A05+ CGATCCAGCGGATAAACCTCAACTTCTATCTAGATTCTAGCCCTTGAAATTCTCTCGATC
JMFS084F05+ CGATCCAGCGGATAAACCTCAACTTCTATCTAGATTCTAGCCCTTGAAATTCTCTCGATC
                      ____________________________________________________________
consensus CGATCCAGCGGATAAACCTCAACTTCTATCTAGATTCTAGCCCTTGAAATTCTCTCGATC
 
. : . : . : . : . : . :
JMFS025B01+ CAAAGGTTCCACAAGGTCTTCGCTTCAAATATAGAGTCTCCGGGCC
JMFF043J16+ CAAAGGTTCCACAAGGTCTTCGCTTCAAATATAGAGTCTCCGGGCCTTCCACTACCAGAG
JMFS134H03+ CAAAGGTTCCACAAGGTCTTCGCTTCAAATATAGAGTCTCCGGGCCTTCCACTACCAGAG
JMFS051A05+ CAAAGGTTCCACAAGGTCTTCGCTTCAAATATAGAGTCTCCGGGCCTTCCACTACCAGAG
JMFS084F05+ CAAAGGTTCCACAAGGTCTTCGCTTCAAATATAGAGTCTCCGGGCCTTCCACTACCAGAG
                      ____________________________________________________________
consensus CAAAGGTTCCACAAGGTCTTCGCTTCAAATATAGAGTCTCCGGGCCTTCCACTACCAGAG
 
. : . : . : . : . : . :
JMFF043J16+ AAAATGCGCTTCTCTCAATTCATGTCCAATC
JMFS134H03+ AAAATGCGCTTCTCTCAATTCATGTCCAATCAATATACGTTATTGCTGTATGAATGTATT
JMFS051A05+ AAAATGCGCTTCTCTCAATTCATGTCCAATCAATATACGTTATTGCTGTATGAATGNATT
JMFS084F05+ AAAATGCGCTTCTCTCAATTCATGTCCAATCAATATACGTTATTGCTGTATGAATGTATT
                      ____________________________________________________________
consensus AAAATGCGCTTCTCTCAATTCATGTCCAATCAATATACGTTATTGCTGTATGAATGTATT
 
. : . : . : . : . : . :
JMFS134H03+ TGTATGTAAAGAGTGAGGAAGGGGTGTGGTG
JMFS051A05+ NGNATGTAAAGAGTGAGGAAGGGGTGNGGTG
JMFS084F05+ TGTATGTAAAGAGTGAGGAAGGGGTGTGGTGTGATCTAGAGAGATATTGACTGAAAATAT
                      ____________________________________________________________
consensus TGTATGTAAAGAGTGAGGAAGGGGTGTGGTGTGATCTAGAGAGATATTGACTGAAAATAT