Previous Contig 003550:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF029H13Sequence418001266 (16)gb:AC145396_17444523e-13Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet673003550 (5)pir|T48515|T485157e-38hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMFS082G10Sequence555003550 (5)gb:AC145396_17444523e-10Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet
JMSF004I13Sequence424001266 (16)gb:AC145396_17444526e-06Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet540003550 (5)gb:AC145396_17444524e-26Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet
JMSF018G23Sequence224001266 (16)gb:AC145396_17444522e-07Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet776003550 (5)pir|T48515|T485151e-52hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi
JMSF042L18Sequence775001266 (16)pir|T48515|T485151e-42hypothetical protein F15N18.150 - Arabidopsis thaliana>gb:ATF15N18_1548743 Arabi837003550 (5)gb:AC145396_17444526e-59Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0042F15, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF042L18+ GAAGTTTTGGCAAAGTCACAGTCTTA
                      ____________________________________________________________
consensus GAAGTTTTGGCAAAGTCACAGTCTTA
 
. : . : . : . : . : . :
rJMSF018G23+ ATAGCAGTAACATCAACAGCCAAAGGCAT-ACTTCC
rJMSF042L18+ CTTTTTTGCACATTCTGTGAAANCATAGCAGTAACATCAACAGCCAAAGGCATAACTTCC
                      ____________________________________________________________
consensus CTTTTTTGCACATTCTGTGAAANCATAGCAGTAACATCAACAGCCAAAGGCATAACTTCC
 
. : . : . : . : . : . :
rJMSF018G23+ AAGCAGCTCCTTATTGGCACAATTGGTGATCAGGTTTTGGCACTAGACAAGCGATTTTTA
rJMSF042L18+ AAGCAGCTCCTTATTGGCACAATTGGTGATCAGGTTTTGGCACTAGACAAGCGATTTTTA
                      ____________________________________________________________
consensus AAGCAGCTCCTTATTGGCACAATTGGTGATCAGGTTTTGGCACTAGACAAGCGATTTTTA
 
. : . : . : . : . : . :
rJMFF029H13+ GAACTGTGAATCCAACTCAAGCTGAGAAAGAGGATGGAATAATACCTCTT
rJMSF018G23+ GATCCTCGGCGAACTGTGAATCCAACTCAAGCTGAGAAAGAGGATGGAATAATACCTCTT
rJMSF042L18+ GATCCTCGGCGAACTGTGAATCCAACTCAAGCTGAGAAAGAGGATGGAATAATACCTCTT
                      ____________________________________________________________
consensus GATCCTCGGCGAACTGTGAATCCAACTCAAGCTGAGAAAGAGGATGGAATAATACCTCTT
 
. : . : . : . : . : . :
rJMFF029H13+ ACTGATTCTTTACCTATAATCCCACAGTCTTATGTGACTCATGCTGTAAAAGCAGAAGGC
rJMSF004I13+ CAGTCTTATGTGACTCATGCTGTAAAAGCAGAAGGC
rJMSF018G23+ ACTGATTCTTTACCTATAATCCCACAGTCTTATGTGACTCATGCTGTTAAAGCGGAAGGC
rJMSF042L18+ ACTGATTCTTTACCTATAATCCCACAGTCTTATGTGACTCATGCTGTAAAAGCAGAAGGC
                      ____________________________________________________________
consensus ACTGATTCTTTACCTATAATCCCACAGTCTTATGTGACTCATGCTGTAAAAGCAGAAGGC
 
. : . : . : . : . : . :
rJMFF029H13+ CTTAGGGGCATAGTAACTGTTCCGGCAAAGCTGGAGTCCACCACCCTCGTCTTTGCTTAT
rJMSF004I13+ CTTAGGGGCATAGTAACTGTTCCGGCAAAGCTGGAGTCCACCACCCTCGTCTTTGCTTAT
rJMSF018G23+ CTTAGAGGCATAGTAACTGTTCCGGCAAAGCTGGAGTCCACCACCCTTGTCTTTGCTTAT
rJMSF042L18+ CTTAGGGGCATAGTAACTGTTCCGGCAAAGCTGGAGTCCACCACCCTCGTCTTTGCTTAT
                      ____________________________________________________________
consensus CTTAGGGGCATAGTAACTGTTCCGGCAAAGCTGGAGTCCACCACCCTCGTCTTTGCTTAT
 
. : . : . : . : . : . :
rJMFF029H13+ GGAGTGGATCTCTTTTTCACCCAGCTTGCTCCTTCAAAGGCCTATGATTCTCTAACGGAC
rJMSF004I13+ GGAGTGGATCTCTTTTTCACCCAGCTTGCTCCTTCAAAGACCTATGATTCTCTAACGGAC
rJMSF018G23+ GGAGTGGATCTCTTTTTCACCCAGCTTGCTCCTTCAAAGACCTATGATTCTCTAACCGAT
rJMSF042L18+ GGAGTGGATCTCTTTTTCACCCAGCTTGCTCCTTCAAAGACCTATGATTCTCTAACGGAC
JMFS082G10- AGTGGATCTCTTTTTCACCCAGCTTGCTCCTTCAAAGACCTATGATTCTCTAACGGAC
                      ____________________________________________________________
consensus GGAGTGGATCTCTTTTTCACCCAGCTTGCTCCTTCAAAGACCTATGATTCTCTAACGGAC
 
. : . : . : . : . : . :
rJMFF029H13+ GACTTCAGTTATGCTCTGCTTCTCCTTACTATTGTTGCACTTGTAGTGGCTATTTTCATA
rJMSF004I13+ GACTTCAGTTATGCTCTGCTTCTCCTTACTATTGTTGCACTTGTAGTGGCTATTTTCATA
rJMSF018G23+ GACTTCAGTTATGCTCTGCTTCTCCTTACCATTGTTGCACTTGTAGTCGCTATTTTCATA
rJMSF042L18+ GACTTCAGTTATGCTCTGCTTCTCCTTACTATTGTTGCACTTGTAGTGGCTATTTTCATA
JMFS082G10- GACTTCAGTTATGCTCTGCTTCTCCTTACTATTGTTGCACTTGTAGTGGCTATTTTCATA
                      ____________________________________________________________
consensus GACTTCAGTTATGCTCTGCTTCTCCTTACTATTGTTGCACTTGTAGTGGCTATTTTCATA
 
. : . : . : . : . : . :
rJMFF029H13+ ACATGGATTTGGTCAGAGCAGAAAGAGCTGCAGGAGAAGTGGAGATGAGTTGAATCAGGT
rJMSF004I13+ ACATGGATTTGGTCAGAGCAGAAAGAGCTGCAGGAGAAGTGGAGATGAGTTGAATCAGGN
rJMSF018G23+ ACATGGATTTGGTCAGAGCAGAAAGAGCTGCAGGAGAAGTGGAGATGAGTTGAATCAGGT
rJMSF042L18+ ACATGGATTTGGTCAGAGCAGAAAGAGCTGCAGGAGAAGTGGAGATGAGTTGAATCAGGT
JMFS082G10- ACATGGATTTGGTCAGAGCAGAAAGAGCTGCAGGAGAAGTGGAGATGAGTTGAATCAGGT
                      ____________________________________________________________
consensus ACATGGATTTGGTCAGAGCAGAAAGAGCTGCAGGAGAAGTGGAGATGAGTTGAATCAGGT
 
. : . : . : . : . : . :
rJMFF029H13+ GAGGTGAC--------------AATCCTCCTGTATTTTACCTAATCTGTTTTGTCCCTTC
rJMSF004I13+ GAGGTGAC--------------AATCCTCCTGTATTTTACCTAATCTGTTTTGTCCCTTC
rJMSF018G23+ GAGGTGACATCCTCGATTTTTTAATCCTCCTGTATTTTACATAATCTGTTTTGTCCCTTC
rJMSF042L18+ GAGGTGAC--------------AATCCTCCTGTATTTTACCTAATCTGTTTTGTCCCTTC
JMFS082G10- GAGGTGAC--------------AATCCTCCTGTATTTTACCTAATCTGTTTTGTCCCTTC
                      ____________________________________________________________
consensus GAGGTGAC--------------AATCCTCCTGTATTTTACCTAATCTGTTTTGTCCCTTC
 
. : . : . : . : . : . :
rJMFF029H13+ CATACAC----ATTGCCCTCCTGTGGAAGAACTAGACGAGCTGTAGTTTTCTTTATTTTA
rJMSF004I13+ CATACAC----ATTGCCCTCCTGTGGAAGAACTAGACGAGCTGTAGTTTTCTTTATTTTA
rJMSF018G23+ CATACACAATCATTGCCCTCCTGTGGAAGAACTAGGCGAGC-------------ATTTTA
rJMSF042L18+ CATACAC----ATTGCCCTCCTGTGGAAGAACTAGACGAGCTGTAGTTTTCTTTATTTTA
JMFS082G10- CATACAC----ATTGCCCTCCTGTGGAAGAACTAGACGAGCTGTAGTTTTCTTTATTTTA
                      ____________________________________________________________
consensus CATACAC----ATTGCCCTCCTGTGGAAGAACTAGACGAGCTGTAGTTTTCTTTATTTTA
 
. : . : . : . : . : . :
rJMFF029H13+ AGTCTGGTCAGTTTACTACCC--AAATAGTAGT--AGCTTTAGGTGATTTTATTTGGAAG
rJMSF004I13+ AGTCTGGTCAGTTTACTACCC--AAATAGTAGT--AGCTTTAGGTGATTTTATTTGGAAG
rJMSF018G23+ AGTCTGGTCAGTTTACTACCCAAAAATAGTAGTATAGCTTTAGGTGATTTTATTGGGAAG
rJMSF042L18+ AGTCTGGTCAGTTTACTACCC--AAATAGTAGT--AGCTTTAGGTGATTTTATTTGGAAG
JMFS082G10- AGTCTGGTCAGTTTACTACCC--AAATAGTAGT--AGCTTTAGGTGATTTTATTTGGAAG
                      ____________________________________________________________
consensus AGTCTGGTCAGTTTACTACCC--AAATAGTAGT--AGCTTTAGGTGATTTTATTTGGAAG
 
. : . : . : . : . : . :
rJMFF029H13+ GGGAAGAGAAACAGGTTTCTGAACATGAACACGGCCGGTTGTCGGCAAGTAGCAAATGTT
rJMSF004I13+ GGGAAGAGAAACAGGTTTCTGAACATGAACACGGCCGGTTGTCAGCAAGTAGCAAATGTT
rJMSF018G23+ GGCAAGAGAAACAGGTTTATGAACATGAACACGGCCGGTTGTCAGCAAGTAGCAAATGTT
rJMSF042L18+ GGGAAGAGAAACAGGTTTCTGAACATGAACACGGCCGGTTGTCAGCAAGTAGCAAATGTT
JMFS082G10- GGGAAGAGAAACAGGTTTCTGAACATGAACACGGCCGGTTGTCAGCAAGTAGCAAATGTT
                      ____________________________________________________________
consensus GGGAAGAGAAACAGGTTTCTGAACATGAACACGGCCGGTTGTCAGCAAGTAGCAAATGTT
 
. : . : . : . : . : . :
rJMFF029H13+ TCTGACGAGCACTTTTGGTTGACATTGAAATTATATTTAATACAATCTGAAGAACCAGCA
rJMSF004I13+ TCTGACGAGCACTTTTGGTTGACATTGAAATTATATTTAATACAAT
rJMSF018G23+ TATGACGAGCACTTATGGTTGACATTGAAATTATA
rJMSF042L18+ TCTGACGAGCACTTTTGGTTGACATTGAAATTATATTTAATACAATCTGAAGAACCAGCA
JMFS082G10- TCTGACGAGCACTTTTGGTTGACATTGAAATTATATTTAATACAATCTGAAGAACCAGCA
                      ____________________________________________________________
consensus TCTGACGAGCACTTTTGGTTGACATTGAAATTATATTTAATACAATCTGAAGAACCAGCA
 
. : . : . : . : . : . :
rJMFF029H13+ AAATGTGCTGTACTGTGTTGTGCGTTTTTGGAATGTTCTTAGCAC
rJMSF042L18+ AAATGTGCTGTACTGTGTTGTGCGTTTTTGGAATGTTCTTAGCACT
JMFS082G10- AAATGTGCTGTACTGTGTTGTGCGTTTTTGGAATGTTCTTAGCACTTAAAGATTGTGTTT
                      ____________________________________________________________
consensus AAATGTGCTGTACTGTGTTGTGCGTTTTTGGAATGTTCTTAGCACTTAAAGATTGTGTTT