Previous Contig 003545:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039B10Sequence436003545 (6)sp|Q40517|NTF3_TOBAC1e-12Mitogen-activated protein kinase homolog NTF3 (EC 2.7.1.37) (P43).>pir|S39559|S3586011022 (3)sp|Q40884|MAPK_PETHY3e-40Mitogen-activated protein kinase homolog 1 (EC 2.7.1.37) (PMEK1).>pir|S52989|S52
JMFF050M07Sequence633003545 (6)sp|Q40517|NTF3_TOBAC6e-47Mitogen-activated protein kinase homolog NTF3 (EC 2.7.1.37) (P43).>pir|S39559|S3566011022 (3)sp|Q40517|NTF3_TOBAC1e-26Mitogen-activated protein kinase homolog NTF3 (EC 2.7.1.37) (P43).>pir|S39559|S3
JMFS082D08Sequence600003545 (6)sp|Q40517|NTF3_TOBAC6e-30Mitogen-activated protein kinase homolog NTF3 (EC 2.7.1.37) (P43).>pir|S39559|S3
JMSF003G18Sequence441003545 (6)sp|Q40517|NTF3_TOBAC8e-06Mitogen-activated protein kinase homolog NTF3 (EC 2.7.1.37) (P43).>pir|S39559|S3
JMSF004G18Sequence465003545 (6)sp|Q40517|NTF3_TOBAC6e-10Mitogen-activated protein kinase homolog NTF3 (EC 2.7.1.37) (P43).>pir|S39559|S3381010276 (7)
JMSF017M12Sequence254003545 (6)sp|Q40517|NTF3_TOBAC3e-23Mitogen-activated protein kinase homolog NTF3 (EC 2.7.1.37) (P43).>pir|S39559|S3601011022 (3)sp|Q40884|MAPK_PETHY5e-36Mitogen-activated protein kinase homolog 1 (EC 2.7.1.37) (PMEK1).>pir|S52989|S52

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050M07+ GAATAGGCAACATGACATCTTTCAGAGAAATCACGTTCGCGT
                      ____________________________________________________________
consensus GAATAGGCAACATGACATCTTTCAGAGAAATCACGTTCGCGT
 
. : . : . : . : . : . :
JMFF050M07+ GTCTAAGATGGCGGAGAAGCTTTATTTCACGCAAAGTTCTCAGCGCATCAACGCGGTTCT
                      ____________________________________________________________
consensus GTCTAAGATGGCGGAGAAGCTTTATTTCACGCAAAGTTCTCAGCGCATCAACGCGGTTCT
 
. : . : . : . : . : . :
JMSF017M12+ CAACTCTTTCGTTCGTTTCCTTGNTGACGGATG
JMFF050M07+ CAAACGCGTTATGTATNTTCTTGATGGCAACTCTTTCGTTCGTTTCCTTGTTGACGGATG
JMFS082D08+ CAAACGCGTTATGTATTTTCTTGATGGCAACTCTTTCGTTCGTTTCCTTGTTGACGGATG
                      ____________________________________________________________
consensus CAAACGCGTTATGTATTTTCTTGATGGCAACTCTTTCGTTCGTTTCCTTGTTGACGGATG
 
. : . : . : . : . : . :
JMSF017M12+ AGCAGACAATNCCATACGCCCCTNGACCAATGGGCTTGATTGGCANGTACTCCGTGTCAA
JMFF050M07+ AGCAGACAATACCATACGCCCCTCGACCAATGGGCTTGATTGGCACGTACTTCGTGTCAA
JMSF004G18+ CTTCGTGTCAA
JMFF039B10+ TTGATTGGCACGTACTTCGTGTCAA
JMFS082D08+ AGCAGACAATACCATACGCCCCTCGACCAATGGGCTTGATTGGCACGTACTTCGTGTCAA
                      ____________________________________________________________
consensus AGCAGACAATACCATACGCCCCTCGACCAATGGGCTTGATTGGCACGTACTTCGTGTCAA
 
. : . : . : . : . : . :
JMSF017M12+ TCTCAAACAACGTTTGCCACATAGAATAGTAATGCTTCCCAGGAGTCATAACTCCATTCG
JMFF050M07+ TCTCAAACAACGTTTGCCACATAGAATAGTAATGCTTCCCAGGAGTCATAACTCCATTCG
JMSF004G18+ TCTCAAACAACGTTTGCCACATAGAATAGTAATGCTTCCCAGGAGTCATAACTCCATTCG
JMSF003G18+ TTGCCACATAGAATAGTAATGCTTCCCAGGAGTCATAACTCCATTCG
JMFF039B10+ TCTCAAACAACGTTTGCCACATAGAATAGTAATGCTTCCCAGGAGTCATAACTCCATTCG
JMFS082D08+ TCTCAAACAACGTTTGCCACATAGAATAGTAATGCTTCCCAGGAGTCATAACTCCATTCG
                      ____________________________________________________________
consensus TCTCAAACAACGTTTGCCACATAGAATAGTAATGCTTCCCAGGAGTCATAACTCCATTCG
 
. : . : . : . : . : . :
JMSF017M12+ GAGGATCAACAGGGGTAGCCGCCATTTCCTTTNGACAACAAATTCTCCTNGAAACCCTTC
JMFF050M07+ GAGGATCAACAGGGGTAGCCGCCATTTCCTTTCGACAACAAATTCTCCTCGAAACCCTTC
JMSF004G18+ GAGGATCAACAGGGGTAGCCGCCATTTCCTTTCGACAACAAATTCTCCTCGAAACCCTTC
JMSF003G18+ GAGGATCAACAGGGGTAGCCGCCATTTCCTTTCGACAACAAATTCTCCTCGAAACCCTTC
JMFF039B10+ GAGGATCAACAGGGGTAGCCGCCATTTCCTTTCGACAACAAATTCTCCTCGAAACCCTTC
JMFS082D08+ GAGGATCAACAGGGGTAGCCGCCATTTCCTTTCGACAACAAATTCTCCTCGAAACCCTTC
                      ____________________________________________________________
consensus GAGGATCAACAGGGGTAGCCGCCATTTCCTTTCGACAACAAATTCTCCTCGAAACCCTTC
 
. : . : . : . : . : . :
JMSF017M12+ ACTGTCGTCTCCTCAGCTCCATCTAAAGATCGAATTTTCC
JMFF050M07+ ACTGTCGTCTCCTCAGCTCCATCTAAAGATCGAATTTTCCAACGAGCTTCAAACCTTTTC
JMSF004G18+ ACTGTCGTCTCCTCAGCTCCATCTAAAGATCGAATTTTCCAACGAGCTTCAAACCTTTTC
JMSF003G18+ ACTGTCGTCTCCTCAGCTCCATCTAAAGATCGAATTTTCCAACGAGCTTCAAACCTTTTC
JMFF039B10+ ACTGTCGTCTCCTCAGCTCCATCTAAAGATCGAATTTTCCAACGAGCTTCAAACCTTTTC
JMFS082D08+ ACTGTCGTCTCCTCAGCTCCATCTAAAGATCGAATTTTCCAACGAGCTTCAAACCTTTTC
                      ____________________________________________________________
consensus ACTGTCGTCTCCTCAGCTCCATCTAAAGATCGAATTTTCCAACGAGCTTCAAACCTTTTC
 
. : . : . : . : . : . :
JMFF050M07+ CCAGATTAAACTCCAATATCTCAGGAAATTCCCGTCCGGTCCCAGCAAACTCGAATTCCC
JMSF004G18+ CCAGATTAAACTCCAATATCTCAGGAAATTCCCGTCCGGTCCCAGCAAACTCGAATTCCC
JMSF003G18+ CCAGATTAAACTCCAATATCTCAGGAAATTCCCGTCCGGTCCCAGCAAACTCGAATTCCC
JMFF039B10+ CCAGATTAAACTCCAATATCTCAGGAAATTCCCGTCCGGTCCCAGCAAACTCGAATTCCC
JMFS082D08+ CCAGATTAAACTCCAATATCTCAGGAAATTCCCGTCCGGTCCCAGCAAACTCGAATTCCC
                      ____________________________________________________________
consensus CCAGATTAAACTCCAATATCTCAGGAAATTCCCGTCCGGTCCCAGCAAACTCGAATTCCC
 
. : . : . : . : . : . :
JMFF050M07+ CAGTGTTAGTCACTAAAAAATCCTCAACCTTTGAGATAACCCAAGTTAATTAGCCCAGAA
JMSF004G18+ CAGTGTTAGTCACTAAAAAATCCTCAACCTTTGAGATAACCCAAGTTAATTAGCCCAGAA
JMSF003G18+ CAGTGTTAGTCACTAAAAAATCCTCAACCTTTGAGATAACCCAAGTTAATTAGCCCAGAA
JMFF039B10+ CAGTGTTAGTCACTAAAAAATCCTCAACCTTTGAGATAACCCAAGTTAATTAGCCCAGAA
JMFS082D08+ CAGTGTTAGTCACTAAAAAATCCTCAACCTTTGAGATAACCCAAGTTAATTAGCCCAGAA
                      ____________________________________________________________
consensus CAGTGTTAGTCACTAAAAAATCCTCAACCTTTGAGATAACCCAAGTTAATTAGCCCAGAA
 
. : . : . : . : . : . :
JMFF050M07+ AACAATTTGATGGCGCCTTAACGAGTCAGATCAGAAGGATCTAAAACAGATTAATTGCCC
JMSF004G18+ AACAATTTGATGGCGCCTTAACGAGTCAGATCAGAAGGATCTAAAACAGATTAATTGCCC
JMSF003G18+ AACAATTTGATGGCGCCTTAACGAGTCAGATCAGAAGGATCTAAAACAGATTAATTGCCC
JMFF039B10+ AACAATTTGATGGCGCCTTAACGAGTCAGATCAGAAGGATCTAAAACAGATTAATTGCCC
JMFS082D08+ AACAATTTGATGGCGCCTTAACGAGTCAGATCAGAAGGATCTAAAACAGATTAATTGCCC
                      ____________________________________________________________
consensus AACAATTTGATGGCGCCTTAACGAGTCAGATCAGAAGGATCTAAAACAGATTAATTGCCC
 
. : . : . : . : . : . :
JMFF050M07+ TAAACATTTCCCCGGCTCCCACAGTAAACGGGTCACTTTACGTCTGTACCC
JMSF004G18+ TAAACATTTCCCCGGCTCCCACAGTAAACGGGTCACTTTACGTCTGTACCCGAACTTTTA
JMSF003G18+ TAAACATTTCCCCGGCTCCCACAGTAAACGGGTCACTTTACGTCTGTACCCGAACTTTTA
JMFF039B10+ TAAACATTTCCCCGGCTCCCACAGTAAACGGGTCACTTTACGTCTGTACCC
JMFS082D08+ TAAACATTTCCCCGGCTCCCACAGTAAACGGGTCACTTTACGTCTGTACCCGAACTTTTA
                      ____________________________________________________________
consensus TAAACATTTCCCCGGCTCCCACAGTAAACGGGTCACTTTACGTCTGTACCCGAACTTTTA
 
. : . : . : . : . : . :
JMSF004G18+ CGGTATATGCTCCAATAGATATCCTTGCCAAAC
JMSF003G18+ CGGTATATGCTCCAATAGATATCCTTGCCAAAC
JMFS082D08+ CGGTATATGCTCCAATAGATATCCTTGCCAAACGCCTAGTGCCCACGACAAGATATTTGA
                      ____________________________________________________________
consensus CGGTATATGCTCCAATAGATATCCTTGCCAAACGCCTAGTGCCCACGACAAGATATTTGA