Previous Contig 003542:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS015E05Sequence590003542 (3)gb:AY092025_15747444e-83Catharanthus roseus cytokinin receptor (CKR1) mRNA, complete cds.
JMFS075A08Sequence622003542 (3)gb:AY092025_15747442e-92Catharanthus roseus cytokinin receptor (CKR1) mRNA, complete cds.
JMFS082B03Sequence617003542 (3)gb:AB011485_15115312e-70Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MXH1.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS075A08+ ATCGAGATTTGTATCCATGA
                      ____________________________________________________________
consensus ATCGAGATTTGTATCCATGA
 
. : . : . : . : . : . :
JMFS075A08+ GCATCTGAAGCATGCCTAAAACACCATTCATTGGGGTCCTGATTTCGTGAGAAACTGTAG
                      ____________________________________________________________
consensus GCATCTGAAGCATGCCTAAAACACCATTCATTGGGGTCCTGATTTCGTGAGAAACTGTAG
 
. : . : . : . : . : . :
JMFS075A08+ CAAGAAACTGGGATTTTGCAATATCTGCAGCCTCAGCACGATGTTTGAGATTCATCATCT
                      ____________________________________________________________
consensus CAAGAAACTGGGATTTTGCAATATCTGCAGCCTCAGCACGATGTTTGAGATTCATCATCT
 
. : . : . : . : . : . :
JMFS075A08+ TCTGATAATCATGCTCAAATTTGGCAATCCGAGCTATTGCAGCGTGAAATATATGACCAA
                      ____________________________________________________________
consensus TCTGATAATCATGCTCAAATTTGGCAATCCGAGCTATTGCAGCGTGAAATATATGACCAA
 
. : . : . : . : . : . :
JMFS075A08+ CAAGCAAGGTGATTACAAGAACACCGATCGAAGCTCCTATTGCTATCCAGGGCGGGGGAG
JMFS015E05+ AGCAAGGTGATTACAAGAACACCGATCGAAGCTCCTATTGCTATCCAGGGCGGGGGAG
                      ____________________________________________________________
consensus CAAGCAAGGTGATTACAAGAACACCGATCGAAGCTCCTATTGCTATCCAGGGCGGGGGAG
 
. : . : . : . : . : . :
JMFS075A08+ GTTTTTGCTTGAACCTGCAATGCATCTCATGCTTCCGAGCAGGATCTCCAAAGTCAAGGT
JMFS015E05+ GTTTTTGCTTGAACCTGCAATGCATCTCATGCTTCCGAGCAGGATCTCCAAAGTCAAGGT
                      ____________________________________________________________
consensus GTTTTTGCTTGAACCTGCAATGCATCTCATGCTTCCGAGCAGGATCTCCAAAGTCAAGGT
 
. : . : . : . : . : . :
JMFS075A08+ TGCTAACATGCAATAATTCTGTCTCGGTCTCATCTGTACCGTACATTTTAATTGGAGAAT
JMFS015E05+ TGCTAACATGCAATAATTCTGTCTCGGTCTCATCTGTACCGTACATTTTAATTGGAGAAT
                      ____________________________________________________________
consensus TGCTAACATGCAATAATTCTGTCTCGGTCTCATCTGTACCGTACATTTTAATTGGAGAAT
 
. : . : . : . : . : . :
JMFS075A08+ ACGTGTTCGTTGTATCATAAACATTTACAACAATAGTGTGTTTGCTCGCAAGTTGGTGAA
JMFS015E05+ ACGTGTTCGTTGTATCATAAACATTTACAACAATAGTGTGTTTGCTCGCAAGTTGGTGAA
                      ____________________________________________________________
consensus ACGTGTTCGTTGTATCATAAACATTTACAACAATAGTGTGTTTGCTCGCAAGTTGGTGAA
 
. : . : . : . : . : . :
JMFS075A08+ GAAGCTTCTCGACTAACGAGGGGACATCGTATGATGCACCAATATACCCGACAGTAGCAT
JMFS015E05+ GAAGCTTCTCGACTAACGAGGGGACATCGTATGATGCACCAATATACCCGACAGTAGCAT
JMFS082B03+ ATACCCGACAGTAGCAT
                      ____________________________________________________________
consensus GAAGCTTCTCGACTAACGAGGGGACATCGTATGATGCACCAATATACCCGACAGTAGCAT
 
. : . : . : . : . : . :
JMFS075A08+ TAATACGTTGATCTGGGGTAGCATCGGGAGCAAGATGAGTGTTATATACAGCAAACGTAA
JMFS015E05+ TAATACGTTGATCTGGGGTAGCATCGGGAGCAAGATGAGTGTTATATACAGCAAACGTAA
JMFS082B03+ TAATACGTTGATCTGGGGTAGCATCGGGAGCAAGATGAGTGTTATATACAGCAAACGTAA
                      ____________________________________________________________
consensus TAATACGTTGATCTGGGGTAGCATCGGGAGCAAGATGAGTGTTATATACAGCAAACGTAA
 
. : . : . : . : . : . :
JMFS075A08+ GTACTACACCCAAGTTATTGGACTTCAATAACTTAAAAGGCGATGTCAAGACTCCCTTCC
JMFS015E05+ GTACTACACCCAAGTTATTGGACTTCAATAACTTAAAAGGCGATGTCAAGACTCCCTTCC
JMFS082B03+ GTACTACACCCAAGTTATTGGACTTCAATAACTTAAAAGGCGATGTCAAGACTCCCTTCC
                      ____________________________________________________________
consensus GTACTACACCCAAGTTATTGGACTTCAATAACTTAAAAGGCGATGTCAAGACTCCCTTCC
 
. : . : . : . : . : . :
JMFS075A08+ CA
JMFS015E05+ CAGATGCCCTTGCCCGCAATATGTTTTCACGGTCTTCCTTTCCAGACATCATATCAATCG
JMFS082B03+ CAGATGCCCTTGCCCGCAATATGTTTTCACGGTCTTCCTTTCCAGACATCATATCAATCG
                      ____________________________________________________________
consensus CAGATGCCCTTGCCCGCAATATGTTTTCACGGTCTTCCTTTCCAGACATCATATCAATCG
 
. : . : . : . : . : . :
JMFS015E05+ AGACAATATGGGAGACAGTTTGTTGAGAAAATATGACTGGCGCATATTCATCTTTATCAG
JMFS082B03+ AGACAATATGGGAGACAGTTTGTTGAGAAAATATGACTGGCGCATATTCATCTTTATCAG
                      ____________________________________________________________
consensus AGACAATATGGGAGACAGTTTGTTGAGAAAATATGACTGGCGCATATTCATCTTTATCAG
 
. : . : . : . : . : . :
JMFS015E05+ GAGCACGATCCAAATTCCCAGGCATATATTCTTGGGCCAAAGTTTGATCCTC
JMFS082B03+ GAGCACGATCCAAATTCCCAGGCATATATTCTTGGGCCAAAGTTTGATCCTCAGATTCCA
                      ____________________________________________________________
consensus GAGCACGATCCAAATTCCCAGGCATATATTCTTGGGCCAAAGTTTGATCCTCAGATTCCA
 
. : . : . : . : . : . :
JMFS082B03+ TTTTCTTAATTGCCCATCCATGTTGCCTCTCAAAATTTTCTCTTTCTGAGTGGAGAACCC
                      ____________________________________________________________
consensus TTTTCTTAATTGCCCATCCATGTTGCCTCTCAAAATTTTCTCTTTCTGAGTGGAGAACCC
 
. : . : . : . : . : . :
JMFS082B03+ TTAGAGCATAGGCAACACCGCTTGTGAGTGGCCTCTCGAAAGCTGTTCTCTCAGTGTATT
                      ____________________________________________________________
consensus TTAGAGCATAGGCAACACCGCTTGTGAGTGGCCTCTCGAAAGCTGTTCTCTCAGTGTATT
 
. : . : . : . : . : . :
JMFS082B03+ CTTCAAAAGTTTTCTGCAACTTGTAAGGAAGCAATATCAGGGTCGGGTATTATAGCATGG
                      ____________________________________________________________
consensus CTTCAAAAGTTTTCTGCAACTTGTAAGGAAGCAATATCAGGGTCGGGTATTATAGCATGG
 
. : . : . : . : . : . :
JMFS082B03+ AAAATAATCAAATATACTCTTTGCAGCCCCGAAGCTAATGAAGAACCAACATCACCTGAT
                      ____________________________________________________________
consensus AAAATAATCAAATATACTCTTTGCAGCCCCGAAGCTAATGAAGAACCAACATCACCTGAT
 
. : . : . : . : . : . :
JMFS082B03+ CTATAGCCGAAGGTTGCTTTCCATGGTGAAAGGTGGAGACAAGAATAGCCAAGGCATGAA
                      ____________________________________________________________
consensus CTATAGCCGAAGGTTGCTTTCCATGGTGAAAGGTGGAGACAAGAATAGCCAAGGCATGAA