Previous Contig 003541:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS066D10Sequence611003541 (4)gb:OSJN00272_16977481e-51Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0095E20, complete seque
JMFS081G12Sequence589003541 (4)gb:AF206320_17767405e-46Musa acuminata pectate lyase 2 (PL2) mRNA, complete cds.
JMFS084C04Sequence608003541 (4)gb:OSJN00272_16977489e-50Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0095E20, complete seque
JMFS142C08Sequence613003541 (4)gb:OSJN00272_16977481e-52Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0095E20, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS142C08+ GTAATAACCATGTCGCGCTTGAAG
JMFS066D10+ ACCATGTCGCGCTTGAAG
JMFS084C04+ GCTTGAAG
                      ____________________________________________________________
consensus GTAATAACCATGTCGCGCTTGAAG
 
. : . : . : . : . : . :
JMFS142C08+ ATAATCCACAGAGGTTCATCCTGGATCACAGCATGGCGAAGAGTGCCAGGCTTAGGGTTC
JMFS066D10+ ATAATCCACAGAGGTTCATCCTGGATCACAGCATGGCGAAGAGTGCCAGGCTTAGGGTTC
JMFS084C04+ ATAATCCACAGAGGTTCATCCTGGATCACAGCATGGCGAAGAGTGCCAGGCTTAGGGTTC
JMFS081G12+ AGGTTCATCCTGGATCACAGCATGGCGAAGAGTGCCAGGCTTAGGGTTC
                      ____________________________________________________________
consensus ATAATCCACAGAGGTTCATCCTGGATCACAGCATGGCGAAGAGTGCCAGGCTTAGGGTTC
 
. : . : . : . : . : . :
JMFS142C08+ ACAGGGTCATCATCAGCATGATCAGTAACAACGTAGAGCTGACCATCACGCCCACCAATG
JMFS066D10+ ACAGGGTCATCATCAGCATGATCAGTAACAACGTAGAGCTGACCATCACGCCCACCAATG
JMFS084C04+ ACAGGGTCATCATCAGCATGATCAGTAACAACGTAGAGCTGACCATCACGCCCACCAATG
JMFS081G12+ ACAGGGTCATCATCAGCATGATCAGTAACAACGTAGAGCTGACCATCACGCCCACCAATG
                      ____________________________________________________________
consensus ACAGGGTCATCATCAGCATGATCAGTAACAACGTAGAGCTGACCATCACGCCCACCAATG
 
. : . : . : . : . : . :
JMFS142C08+ GCATTGCGCCCAAACCCAATTCCACAGTCCGCAAGACGCTGGCGATTATTGTGCCAATTT
JMFS066D10+ GCATTGCGCCCAAACCCAATTCCACAGTCCGCAAGACGCTGGCGATTATTGTGCCAATTT
JMFS084C04+ GCATTGCGCCCAAACCCAATTCCACAGTCCGCAAGACGCTGGCGATTATTGTGCCAATTT
JMFS081G12+ GCATTGCGCCCAAACCCAATTCCACAGTCCGCAAGACGCTGGCGATTATTGTGCCAATTT
                      ____________________________________________________________
consensus GCATTGCGCCCAAACCCAATTCCACAGTCCGCAAGACGCTGGCGATTATTGTGCCAATTT
 
. : . : . : . : . : . :
JMFS142C08+ GGGTCACAACGCCAGCAGTCATCAATCGGATTACCAGTCCCACATGAGAAATATCCAAGT
JMFS066D10+ GGGTCACAACGCCAGCAGTCATCAATCGGATTACCAGTCCCACATGAGAAATATCCAAGT
JMFS084C04+ GGGTCACAACGCCAGCAGTCATCAATCGGATTACCAGTCCCACATGAGAAATATCCAAGT
JMFS081G12+ GGGTCACAACGCCAGCAGTCATCAATCGGATTACCAGTCCCACATGAGAAATATCCAAGT
                      ____________________________________________________________
consensus GGGTCACAACGCCAGCAGTCATCAATCGGATTACCAGTCCCACATGAGAAATATCCAAGT
 
. : . : . : . : . : . :
JMFS142C08+ TTTCGCCTCTCTGTGCTATTCCTGATGCTCTCTGCAACCATGGAGGCGACCTCTTCAGGA
JMFS066D10+ TTTCGCCTCTCTGTGCTATTCCTGATGCTCTCTGCAACCATGGAGGCGACCTCTTCAGGA
JMFS084C04+ TTTCGCCTCTCTGTGCTATTCCTGATGCTCTCTGCAACCATGGAGGCGACCTCTTCAGGA
JMFS081G12+ TTTCGCCTCTCTGTGCTATTCCTGATGCTCTCTGCAACCATGGAGGCGACCTCTTCAGGA
                      ____________________________________________________________
consensus TTTCGCCTCTCTGTGCTATTCCTGATGCTCTCTGCAACCATGGAGGCGACCTCTTCAGGA
 
. : . : . : . : . : . :
JMFS142C08+ TCATCAACCGCCTGCTTGCTCAAAGCCTCTTCAACCTCCGCCAACCTTGCCGCCATTGTT
JMFS066D10+ TCATCAACCGCCTGCTTGCTCAAAGCCTCTTCAACCTCCGCCAACCTTGCCGCCATTGTT
JMFS084C04+ TCATCAACCGCCTGCTTGCTCAAAGCCTCTTCAACCTCCGCCAACCTTGCCGCCATTGTT
JMFS081G12+ TCATCAACCGCCTGCTTGCTCAAAGCCTCTTCAACCTCCGCCAACCTTGCCGCCATTGTT
                      ____________________________________________________________
consensus TCATCAACCGCCTGCTTGCTCAAAGCCTCTTCAACCTCCGCCAACCTTGCCGCCATTGTT
 
. : . : . : . : . : . :
JMFS142C08+ GAGTTGTGCGAGCTCTGCAATTCCTCCTTCTCCGCAGTCCTCAAGTCGGAACCGCCATTA
JMFS066D10+ GAGTTGTGCGAGCTCTGCAATTCCTCCTTCTCCGCAGTCCTCAAGTCGGAACCGCCATTA
JMFS084C04+ GAGTTGTGCGAGCTCTGCAATTCCTCCTTCTCCGCAGTCCTCAAGTCGGAACCGCCATTA
JMFS081G12+ GAGTTGTGCGAGCTCTGCAATTCCTCCTTCTCCGCAGTCCTCAAGTCGGAACCGCCATTA
                      ____________________________________________________________
consensus GAGTTGTGCGAGCTCTGCAATTCCTCCTTCTCCGCAGTCCTCAAGTCGGAACCGCCATTA
 
. : . : . : . : . : . :
JMFS142C08+ CTGTGTACTCTAGCAAAAACTCCGGCGACGAACAAGAGAAGCAGCAGAGAGCTCAGACAA
JMFS066D10+ CTGTGTACTCTAGCAAAAACTCCGGCGACGAACAAGAGAAGCAGCAGAGAGCTCAGACAA
JMFS084C04+ CTGTGTACTCTAGCAAAAACTCCGGCGACGAACAAGAGAAGCAGCAGAGAGCTCAGACAA
JMFS081G12+ CTGTGTACTCTAGCAAAAACTCCGGCGACGAACAAGAGAAGCAGCAGAGAGCTCAGACAA
                      ____________________________________________________________
consensus CTGTGTACTCTAGCAAAAACTCCGGCGACGAACAAGAGAAGCAGCAGAGAGCTCAGACAA
 
. : . : . : . : . : . :
JMFS142C08+ AACGAAGCACGTTTCTTCCACCCCGCCATTGCCGCTAACGATGATAACTCGCTTCCCGTT
JMFS066D10+ AACGAAGCACGTTTCTTCCACCCCGCCATTGCCGCTAACGATGATAACTCGCTTCCCGTT
JMFS084C04+ AACGAAGCACGTTTCTTCCACCCCGCCATTGCCGCTAACGATGATAACTCGCTTCCCGTT
JMFS081G12+ AACGAAGCACGTTTCTTCCACCCCGCCATTGCCGCTAACGATGATAACTCGCTTCCCGTT
                      ____________________________________________________________
consensus AACGAAGCACGTTTCTTCCACCCCGCCATTGCCGCTAACGATGATAACTCGCTTCCCGTT
 
. : . : . : . : . : . :
JMFS142C08+ CCCCCCTCTCTCTCTAGAACTTTTGGGGAAGGAAAGAATGATATTTGGA
JMFS066D10+ CCCCCCTCTCTCTCTAGAACTTTTGGGGAAGGAAAGAATGATATTTGGA
JMFS084C04+ CCCCCCTCTCTCTCTAGAACTTTTGGGGAAGGAAAGAATGATATTTGGAGAGA
JMFS081G12+ CCCCCCTCTCTCTCTAGAACTTTTGGGGAAGGAAAGAATGATATTTGGAGAGAGAATTAA
                      ____________________________________________________________
consensus CCCCCCTCTCTCTCTAGAACTTTTGGGGAAGGAAAGAATGATATTTGGAGAGAGAATTAA