Previous Contig 003533:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS049E07Sequence607003533 (3)gb:AJ630505_18127645e-44Solanum tuberosum partial mRNA for MYC transcription factor (jamyc2 gene).
JMFS064G07Sequence622003533 (3)gb:AJ630505_18127647e-45Solanum tuberosum partial mRNA for MYC transcription factor (jamyc2 gene).
JMFS081D01Sequence633003533 (3)gb:AJ630505_18127648e-41Solanum tuberosum partial mRNA for MYC transcription factor (jamyc2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS049E07+ TGGGTCATGGA
JMFS064G07+ AGGTGTAGAACGCTTGGCCTGGTAGACCGGACCCGGTCATGAACGATTGGGTCATGGA
                      ____________________________________________________________
consensus AGGTGTAGAACGCTTGGCCTGGTAGACCGGACCCGGTCATGAACGATTGGGTCATGGA
 
. : . : . : . : . : . :
JMFS049E07+ AACCAGAAANAACCACTCGGTGTCCGTGACTTCCTCGTCGACGGCGTCGTCGGTGGAGGC
JMFS064G07+ AACCAGAAANAACCACTCGGTGTCCGTGACTTCCTCGTCGACGGCGTCGTCGGTGGAGGC
JMFS081D01+ GACTTCCTCGTCGACGGCGTCGTCGGTGGAGGC
                      ____________________________________________________________
consensus AACCAGAAANAACCACTCGGTGTCCGTGACTTCCTCGTCGACGGCGTCGTCGGTGGAGGC
 
. : . : . : . : . : . :
JMFS049E07+ GGGGCCGGAAATTAAAGAATTGAGCTCCCGGAGGACTTTTTTCCGGTGCTCTTGCTCCGC
JMFS064G07+ GGGGCCGGAAATTAAAGAATTGAGCTCCCGGAGGACTTTTTTCCGGTGCTCTTGCTCCGC
JMFS081D01+ GGGGCCGGAAATTAAAGAATTGAGCTCCCGGAGGACTTTTTTCCGGTGCTCTTGCTCCGC
                      ____________________________________________________________
consensus GGGGCCGGAAATTAAAGAATTGAGCTCCCGGAGGACTTTTTTCCGGTGCTCTTGCTCCGC
 
. : . : . : . : . : . :
JMFS049E07+ TATCGACGCCGGCGACGACCCTTTCTTGCTCCGCTTCGCCTTATCCTCCTCCCCTTTATA
JMFS064G07+ TATCGACGCCGGCGACGACCCTTTCTTGCTCCGCTTCGCCTTATCCTCCTCCCCTTTATA
JMFS081D01+ TATCGACGCCGGCGACGACCCTTTCTTGCTCCGCTTCGCCTTATCCTCCTCCCCTTTATA
                      ____________________________________________________________
consensus TATCGACGCCGGCGACGACCCTTTCTTGCTCCGCTTCGCCTTATCCTCCTCCCCTTTATA
 
. : . : . : . : . : . :
JMFS049E07+ GTACCCGTCGCCCCACCCTAGAAACGCCTGCGCGGCGAAGTCGTCGACGGAGCTCTGCCA
JMFS064G07+ GTACCCGTCGCCCCACCCTAGAAACGCCTGCGCGGCGAAGTCGTCGACGGAGCTCTGCCA
JMFS081D01+ GTACCCGTCGCCCCACCCTAGAAACGCCTGCGCGGCGAAGTCGTCGACGGAGCTCTGCCA
                      ____________________________________________________________
consensus GTACCCGTCGCCCCACCCTAGAAACGCCTGCGCGGCGAAGTCGTCGACGGAGCTCTGCCA
 
. : . : . : . : . : . :
JMFS049E07+ GAAAATAGCGTACGTCCAGCTCTCCTGCGCGCCGTCGATCAGCGTCTGCAGCCGCTGCTG
JMFS064G07+ GAAAATAGCGTACGTCCAGCTCTCCTGCGCGCCGTCGATCAGCGTCTGCAGCCGCTGCTG
JMFS081D01+ GAAAATAGCGTACGTCCAGCTCTCCTGCGCGCCGTCGATCAGCGTCTGCAGCCGCTGCTG
                      ____________________________________________________________
consensus GAAAATAGCGTACGTCCAGCTCTCCTGCGCGCCGTCGATCAGCGTCTGCAGCCGCTGCTG
 
. : . : . : . : . : . :
JMFS049E07+ TAGCGTCTCCTGGTTGAACGCCGCCGCCGCAGGCGGCGGCGGCGG
JMFS064G07+ TAGCGTCTCCTGGTTGAACGCCGCCGCCGCAGGCGGCGGCGGCGG
JMFS081D01+ TAGCGTCTCCTGGTTGAACGCCGCCGCCGCAGGCGGCGGCGGCGGCGCGTGAGCAGACGT
                      ____________________________________________________________
consensus TAGCGTCTCCTGGTTGAACGCCGCCGCCGCAGGCGGCGGCGGCGGCGCGTGAGCAGACGT
 
. : . : . : . : . : . :
JMFS081D01+ CGTAGTCATCGCCGCCGACGCGCCGCCGCCGTTGTTGGTAGTAGCAGTAGTGGACGGCGG
                      ____________________________________________________________
consensus CGTAGTCATCGCCGCCGACGCGCCGCCGCCGTTGTTGGTAGTAGCAGTAGTGGACGGCGG
 
. : . : . : . : . : . :
JMFS081D01+ GAGCCAAAACTGGGGCATATCGGAGGACAAGAACGCCTCCATCATGGACGCGTCATCGCC
                      ____________________________________________________________
consensus GAGCCAAAACTGGGGCATATCGGAGGACAAGAACGCCTCCATCATGGACGCGTCATCGCC
 
. : . : . : . : . : . :
JMFS081D01+ GGCGGCGGACGCCGTGGCGGCCCAGAGATTCGTCGACGGTAGCCTATAATCCGTCATCCA
                      ____________________________________________________________
consensus GGCGGCGGACGCCGTGGCGGCCCAGAGATTCGTCGACGGTAGCCTATAATCCGTCATCCA
 
. : . : . : . : . : . :
JMFS081D01+ ACAATCGGACTTGAGATTCACAGTGAAAATTCTCGCCGGATTTTCAAGAAACTGAGCAGT
                      ____________________________________________________________
consensus ACAATCGGACTTGAGATTCACAGTGAAAATTCTCGCCGGATTTTCAAGAAACTGAGCAGT
 
. : . : . : . : . : . :
JMFS081D01+ GGAGTCTGCTCTCTTACTGTATTTTTAGAGAGAGAGAGAGTTGGGAGGAAGAGAGTGGTG
                      ____________________________________________________________
consensus GGAGTCTGCTCTCTTACTGTATTTTTAGAGAGAGAGAGAGTTGGGAGGAAGAGAGTGGTG