Previous Contig 003526:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045A15Sequence484003526 (9)gb:AB029460_15181942e-18Salix gilgiana SgPG4 mRNA for polygalacturonase, complete cds.512009938 (8)gb:AY062447_15651031e-29Arabidopsis thaliana polygalacturonase; pectinase (At3g14060; MDC16.18) mRNA, co
JMFN037I23Sequence607003526 (9)gb:AB029457_15181913e-25Salix gilgiana SgPG1 mRNA for polygalacturonase, complete cds.
JMFS037F05Sequence595003526 (9)gb:AB029457_15181914e-17Salix gilgiana SgPG1 mRNA for polygalacturonase, complete cds.
JMFS073D10Sequence642003526 (9)pir|S34200|S342005e-36polygalacturonase (EC 3.2.1.15) [imported] - Arabidopsis thaliana>gb:ATEXOPB_154
JMFS080F03Sequence608003526 (9)gb:AB029457_15181913e-25Salix gilgiana SgPG1 mRNA for polygalacturonase, complete cds.
JMFS080G02Sequence624003526 (9)gb:AB029457_15181911e-27Salix gilgiana SgPG1 mRNA for polygalacturonase, complete cds.
JMFS102F12Sequence597003526 (9)pir|S34200|S342002e-28polygalacturonase (EC 3.2.1.15) [imported] - Arabidopsis thaliana>gb:ATEXOPB_154
JMFS135G05Sequence630003526 (9)gb:AB029457_15181918e-27Salix gilgiana SgPG1 mRNA for polygalacturonase, complete cds.
JMFS144A03Sequence623003526 (9)pir|S34200|S342001e-35polygalacturonase (EC 3.2.1.15) [imported] - Arabidopsis thaliana>gb:ATEXOPB_154

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN037I23+ TGCATTGTATCA
JMFS144A03+ CAACGTCAGGTTCTTGCATTGTATCA
JMFS080G02+ TTCAACGTCAGGTTCTTGCATTGTATCA
JMFS135G05+ TGTATCA
JMFS080F03+ TGCATTGTATCA
                      ____________________________________________________________
consensus TTCAACGTCAGGTTCTTGCATTGTATCA
 
. : . : . : . : . : . :
JMFF045A15+ GCTGTCCACAGAC-TTATTCCTTTCACCACCGCGTTCGTCA
JMFN037I23+ CATTCATGTGGAAAAACTTGCTGTCCACAGACTTTATTCCTTTCACCACCGCGTTCGTCA
JMFS102F12+ AAAAACTTGCTGTCCACAGACTTTATTCCTTTCACCACCGAGTTCGTCA
JMFS144A03+ CATTCATGTGGAAAAACTTGCTGTCCACAGACTTTATTCCTTTCACCACCGAGTTCGTCA
JMFS080G02+ CATTCATGTGGAAAAACTTGCTGTCCACAGACTTTATTCCTTTCACCACCGCGTTCGTCA
JMFS135G05+ CATTCATGTGGAAAAACTTGCTGTCCACAGACTTTATTCCTTTCACCACCGCGTTCGTCA
JMFS080F03+ CATTCATGTGGAAAAACTTGCTGTCCACAGACTTTATTCCTTTCACCACCGCGTTCGTCA
                      ____________________________________________________________
consensus CATTCATGTGGAAAAACTTGCTGTCCACAGACTTTATTCCTTTCACCACCGCGTTCGTCA
 
. : . : . : . : . : . :
JMFF045A15+ ACGTACCCAAGTTCATGTTAATGGGGAGGTTTTTACAAAGGGGATTATTCATATTCTCCT
JMFN037I23+ ACGTACCCAAGTTCATGTTAATGGGGAGGTTTTTACAAAGGGGATTATTCATATTCTCCT
JMFS073D10+ AATGGGGAGGTTTTTACAAAGGGGAGCATTCATATTCTCCT
JMFS102F12+ ACGTACCCAAGTTCATGTTAATGGGGAGGTTTTTACAAAGGGGAGCATTCATATTCTCCT
JMFS144A03+ ACGTACCCAAGTTAATGTTAATGGGGAGGTTTTTACAAAGGGGAGCATTCATATTCTCCT
JMFS080G02+ ACGTACCCAAGTTCATGTTAATGGGGAGGTTTTTACAAAGGGGATTATTCATATTCTCCT
JMFS037F05+ AATGGGGAGGTTTTTACAAAGGGGATTATTCATATTCTCCT
JMFS135G05+ ACGTACCCAAGTTCATGTTAATGGGGAGGTTTTTACAAAGGGGATTATTCATATTCTCCT
JMFS080F03+ ACGTACCCAAGTTCATGTTAATGGGGAGGTTTTTACAAAGGGGATTATTCATATTCTCCT
                      ____________________________________________________________
consensus ACGTACCCAAGTTCATGTTAATGGGGAGGTTTTTACAAAGGGGATTATTCATATTCTCCT
 
. : . : . : . : . : . :
JMFF045A15+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
JMFN037I23+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
JMFS073D10+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
JMFS102F12+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
JMFS144A03+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
JMFS080G02+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
JMFS037F05+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
JMFS135G05+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
JMFS080F03+ TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
                      ____________________________________________________________
consensus TACACTTGTTTATCTTCCAGGCGGCGGAACCTTGGCCGTTATAAGTACCGCCGGAGAGCG
 
. : . : . : . : . : . :
JMFF045A15+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGATTGAGAT
JMFN037I23+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGATTGAGAT
JMFS073D10+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGACTGAGAT
JMFS102F12+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGACTGAGAT
JMFS144A03+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGACTGAGAT
JMFS080G02+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGATTGAGAT
JMFS037F05+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGACTAAGAT
JMFS135G05+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGACTAAGAT
JMFS080F03+ TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGATTGAGAT
                      ____________________________________________________________
consensus TAAAGTCTTTAATCATGCTGAACAAAATCCATCCATCTTTTGTTTTGAACTGACTGAGAT
 
. : . : . : . : . : . :
JMFF045A15+ CAGTTGGCGCGATCAATTTGGCACCTT---CCGCATCAAATGTTACGGCACTCTTACAAG
JMFN037I23+ CAGTTGGCGCGATCAATTTGGCACCTT---CCGCATCAAATGTTACGGCACTCTTACAAG
JMFS073D10+ CGGTTGGCGCGATAAATTTGGCACCTTCCGCCGCATCAAATGTTACGGCACTCTTACAAG
JMFS102F12+ CGGTTGGCGCGATAAATTTGGCACCTTCCGCCGCATCAAATGTTACGGCACTCTTACAAG
JMFS144A03+ CGGTTGGCGCGATAAATTTGGCACCTTCCGCCGCATCAAATGTTACGGCACTCTTACAAG
JMFS080G02+ CAGTTGGCGCGATCAATTTGGCACCTT---CCGCATCAAATGTTACGGCACTCTTACAAG
JMFS037F05+ CAGTTGGCGCGATCAATTTAGCACCTT---CCGCATCAAATGTTACGGCACTCTTACAAG
JMFS135G05+ CAGTTGGCGCGATCAATTTAGCACCTT---CCGCATCAAATGTTACGGCACTCTTACAAG
JMFS080F03+ CAGTTGGCGCGATCAATTTGGCACCTT---CCGCATCAAATGTTACGGCACTCTTACAAG
                      ____________________________________________________________
consensus CAGTTGGCGCGATCAATTTGGCACCTT---CCGCATCAAATGTTACGGCACTCTTACAAG
 
. : . : . : . : . : . :
JMFF045A15+ GACCTAGAAACCCAATCTGACCCAACCTATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
JMFN037I23+ GACCTAGAAACCCAATCTGACCCAACCTATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
JMFS073D10+ GACCTAGAAACCCAATCTGACCCAACATATACTTGCCTTTCGGAACCTTGAGCGTGCTCG
JMFS102F12+ GACCTAGAAACCCAATCTGACCCAACATATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
JMFS144A03+ GACCTAGAAACCCAATCTGACCCAACATATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
JMFS080G02+ GACCTAGAAACCCAATCTGACCCAACCTATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
JMFS037F05+ GACCTAGAAACCCAATCTGACCCAACCTATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
JMFS135G05+ GACCTAGAAACCCAATCTGACCCAACCTATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
JMFS080F03+ GACCTAGAAACCCAATCTGACCCAACCTATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
                      ____________________________________________________________
consensus GACCTAGAAACCCAATCTGACCCAACCTATACTTGCCTTCCGGAACCTTGAGCGTGCTCG
 
. : . : . : . : . : . :
JMFF045A15+ GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCCAT
JMFN037I23+ GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCCAT
JMFS073D10+ GCTCTGTCCCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCAAT
JMFS102F12+ GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCAAT
JMFS144A03+ GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCAAT
JMFS080G02+ GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCCAT
JMFS037F05+ GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCCAT
JMFS135G05+ GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCCAT
JMFS080F03+ GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCCAT
                      ____________________________________________________________
consensus GCTCTGTCGCTTTGCATACCTCATCCCAAGCTTTCTTAAAAGCCGCAGTATCATCGCCAT
 
. : . : . : . : . : . :
JMFF045A15+ CGTCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTATTGTTGCTA
JMFN037I23+ CGTCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTATTGTTGCTA
JMFS073D10+ CCCCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTACTGTTGCTA
JMFS102F12+ CCCCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTACTGTTGCTA
JMFS144A03+ CCCCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTACTGTTGCTA
JMFS080G02+ CGTCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTATTGTTGCTA
JMFS037F05+ CGTCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTATTGTTGCTA
JMFS135G05+ CGTCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTATTGTTGCTA
JMFS080F03+ CGTCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTATTGTTGCTA
                      ____________________________________________________________
consensus CGTCATCACCTTTTGCACCAGATGTTTTAACGTTAACTTCAACGCCCTGTATTGTTGCTA
 
. : . : . : . : . : . :
JMFF045A15+ CAAGATATGTCACATAGAAAAAAATCA
JMFN037I23+ CAAGATATGTCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATCTCTT
JMFS073D10+ CAAGATATGCCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATC
JMFS102F12+ CAAGATATGCCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATC
JMFS144A03+ CAAGATATGCCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATCTC
JMFS080G02+ CAAGATATGTCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATCTC-T
JMFS037F05+ CAAGATATGTCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATCTC-T
JMFS135G05+ CAAGATATGTCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATCTC-T
JMFS080F03+ CAAGATATGTCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATCTC-T
                      ____________________________________________________________
consensus CAAGATATGTCACATAGAAAAAAATCAATGCAGCTTGAATCGCATTGGAACCCATCTC-T
 
. : . : . : . : . : . :
JMFN037I23+ TTTTTTTTTTTTGTGTATTTATTTTATTTTATTTT
JMFS080G02+ TTTTTTTTTTTTGTGTATTTATTTTATTTTATTTT
JMFS037F05+ TTTTTTTTTTTTGT
JMFS135G05+ TTTTTTTTTTTTGTGTATTTATTTTATTTTATTTT
JMFS080F03+ TTTTTTTTTTTTGTGTATTTATTTTATTTTATTTTCCTTTATACAGCTGGTTGAGATACA
                      ____________________________________________________________
consensus TTTTTTTTTTTTGTGTATTTATTTTATTTTATTTTCCTTTATACAGCTGGTTGAGATACA