Previous Contig 003524:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006J03Sequence586003524 (2)gb:AY085941_15710034e-62Arabidopsis thaliana clone 19901 mRNA, complete sequence.758020770gb:AY085941_15710037e-75Arabidopsis thaliana clone 19901 mRNA, complete sequence.
JMFS080D05Sequence619003524 (2)gb:AY085941_15710034e-75Arabidopsis thaliana clone 19901 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS080D05+ GTAAACCGAACGCGGAGATC
                      ____________________________________________________________
consensus GTAAACCGAACGCGGAGATC
 
. : . : . : . : . : . :
JMFF006J03+ CGAGCGCGCTTTGATATGACAGGTTG
JMFS080D05+ AGGAGGAATATGAGCCCTTCGATGAAAATGGCGGCGAGCGCGCTTTGATATGACAGGTTG
                      ____________________________________________________________
consensus AGGAGGAATATGAGCCCTTCGATGAAAATGGCGGCGAGCGCGCTTTGATATGACAGGTTG
 
. : . : . : . : . : . :
JMFF006J03+ CCGGAGCCATGGAAACCGACGACGGGTGTACGCGAAATACGCGTTGGCGCCCATTCCGGG
JMFS080D05+ CCGGAGCCATGGAAACCGACGAC-GGTGTACGCGAAATACGCGTTGGCGCCCATTCCGGG
                      ____________________________________________________________
consensus CCGGAGCCATGGAAACCGACGACGGGTGTACGCGAAATACGCGTTGGCGCCCATTCCGGG
 
. : . : . : . : . : . :
JMFF006J03+ CGCTAATGCCAGCGGCAAATTCGCGAACACGCCCATAATCACGCAACCGATCAAGGACGA
JMFS080D05+ CGCTAATGCCAGCGGCAAATTCGCGAACACGCCCATAATCACGCAACCGATCAAGGACGA
                      ____________________________________________________________
consensus CGCTAATGCCAGCGGCAAATTCGCGAACACGCCCATAATCACGCAACCGATCAAGGACGA
 
. : . : . : . : . : . :
JMFF006J03+ CGCCACGGTGGCGACGATCAGATCCTTCCGCGTTTTCTCGAGACAGGCGGCGTAGCCGGG
JMFS080D05+ CGCCACGGTGGCGACGATCAGATCCTTCCGCGTTTTCTCGAGACAGGCGGCGTAGCCGGG
                      ____________________________________________________________
consensus CGCCACGGTGGCGACGATCAGATCCTTCCGCGTTTTCTCGAGACAGGCGGCGTAGCCGGG
 
. : . : . : . : . : . :
JMFF006J03+ GTTGACGGGGTTGAACTTGCAGGACTCGTCGGGAGACACGATTTGAGTGCAGTTAGAGAG
JMFS080D05+ GTTGACGGGGTTGAACTTGCAGGACTCGTCGGGAGACACGATTTGAGTGCAGTTAGAGAG
                      ____________________________________________________________
consensus GTTGACGGGGTTGAACTTGCAGGACTCGTCGGGAGACACGATTTGAGTGCAGTTAGAGAG
 
. : . : . : . : . : . :
JMFF006J03+ CGGGACAGTGGGGTCGCCGCCGCAGAGGGCGAGGCAGTCGGAGACGGAGCACGTGCCGCC
JMFS080D05+ CGGGACAGTGGGGTCGCCGCCGCAGAGGGCGAGGCAGTCGGAGACGGAGCACGTGCCGCC
                      ____________________________________________________________
consensus CGGGACAGTGGGGTCGCCGCCGCAGAGGGCGAGGCAGTCGGAGACGGAGCACGTGCCGCC
 
. : . : . : . : . : . :
JMFF006J03+ GGAATCGGACAGGATGGAAGCGTTCACGGCGAGGATGTAGGCCATGGTGAGGAAGGTGGC
JMFS080D05+ GGAATCGGACAGGATGGAAGCGTTCACGGCGAGGATGTAGGCCATGGTGAGGAAGGTGGC
                      ____________________________________________________________
consensus GGAATCGGACAGGATGGAAGCGTTCACGGCGAGGATGTAGGCCATGGTGAGGAAGGTGGC
 
. : . : . : . : . : . :
JMFF006J03+ AGTGCCGGCGCGGAGCTCGGTGGTGAAGGTGGTGTTCCGCTCCTTGAGTTTGAAACGCTT
JMFS080D05+ AGTGCCGGCGCGGAGCTCGGTGGTGAAGGTGGTGTTCCGCTCCTTGAGTTTGAAACGCTT
                      ____________________________________________________________
consensus AGTGCCGGCGCGGAGCTCGGTGGTGAAGGTGGTGTTCCGCTCCTTGAGTTTGAAACGCTT
 
. : . : . : . : . : . :
JMFF006J03+ GCC
JMFS080D05+ GCCAACTGGACTTCTCTCTACAAAGGAATTGAGACGCGACACCGGAGACCGTCCAGTGTT
                      ____________________________________________________________
consensus GCCAACTGGACTTCTCTCTACAAAGGAATTGAGACGCGACACCGGAGACCGTCCAGTGTT
 
. : . : . : . : . : . :
JMFS080D05+ GGCCGCCGCCGCCGCCGCAAGTGGTGGCGGAGATAAACTCCCTGCCTCCAGGTCCATTGT
                      ____________________________________________________________
consensus GGCCGCCGCCGCCGCCGCAAGTGGTGGCGGAGATAAACTCCCTGCCTCCAGGTCCATTGT