Previous Contig 003523:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS024C04Sequence629003523 (4)pir|T48012|T480121e-62hypothetical protein T17J13.160 - Arabidopsis thaliana>gb:ATT17J13_1554731 Arabi
JMFS080D02Sequence660003523 (4)pir|T48012|T480121e-62hypothetical protein T17J13.160 - Arabidopsis thaliana>gb:ATT17J13_1554731 Arabi
JMFS145D07Sequence617003523 (4)pir|T48012|T480124e-63hypothetical protein T17J13.160 - Arabidopsis thaliana>gb:ATT17J13_1554731 Arabi
JMSF022A23Sequence654003523 (4)pir|T48012|T480122e-48hypothetical protein T17J13.160 - Arabidopsis thaliana>gb:ATT17J13_1554731 Arabi771023012

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF022A23+ TCCATAACTGCTATTTACAAACTGCTTTGATT
                      ____________________________________________________________
consensus TCCATAACTGCTATTTACAAACTGCTTTGATT
 
. : . : . : . : . : . :
JMSF022A23+ CAGTATTAGTAAGAGCAGGGCCCCCAGCTGAAAGGCTTGTCCAGAGCCATACAGTCTTGG
JMFS145D07+ G
                      ____________________________________________________________
consensus CAGTATTAGTAAGAGCAGGGCCCCCAGCTGAAAGGCTTGTCCAGAGCCATACAGTCTTGG
 
. : . : . : . : . : . :
JMSF022A23+ CTGCAGCAACAAGTGCAGCAGATGCTTTTTGAGGTTGTGCTAAAAGAATATTATATCTAC
JMFS145D07+ CTGCAGCAACAAGTGCAGCAGATGCTTTTTGAGGTTGTGCTAAAAGAATATTATATCTAC
JMFS024C04+ CTGCAGCAACAAGTGCAGCAGATGCTTTTTGAGGTTGTGCTAAAAGAATATTATATCTAC
JMFS080D02+ CTGCAGCAACAAGTGCAGCAGATGCTTTTTGAGGTTGTGCTAAAAGAATATTATATCTAC
                      ____________________________________________________________
consensus CTGCAGCAACAAGTGCAGCAGATGCTTTTTGAGGTTGTGCTAAAAGAATATTATATCTAC
 
. : . : . : . : . : . :
JMSF022A23+ GCATGCGCAGCTGGTGGAGAGCATTAGAAAAATCCCGGTCACCAGATATCAATAGATAAT
JMFS145D07+ GCATGCGCAGCTGGTGGAGAGCATTAGAAAAATCCCGGTCACCAGATATCAATAGATAAT
JMFS024C04+ GCATGCGCAGCTGGTGGAGAGCATTAGAAAAATCCCGGTCACCAGATATCAATAGATAAT
JMFS080D02+ GCATGCGCAGCTGGTGGAGAGCATTAGAAAAATCCCGGTCACCAGATATCAATAGATAAT
                      ____________________________________________________________
consensus GCATGCGCAGCTGGTGGAGAGCATTAGAAAAATCCCGGTCACCAGATATCAATAGATAAT
 
. : . : . : . : . : . :
JMSF022A23+ TAGCAGGTGCAGGATTGTCAACTGCCCAGAATAACATATCCACCAGAATCTTCTTATCGC
JMFS145D07+ TAGCAGGTGCAGGATTGTCAACTGCCCAGAATAACATATCCACCAGAATCTTCTTATCGC
JMFS024C04+ TAGCAGGTGCAGGATTATCAACTGCCCAGAATAACATATCCACCAGAATCTTCTTATCGC
JMFS080D02+ TAGCAGGTGCAGGATTGTCAACTGCCCAGAATAACATATCCACCAGAATCTTCTTATCGC
                      ____________________________________________________________
consensus TAGCAGGTGCAGGATTGTCAACTGCCCAGAATAACATATCCACCAGAATCTTCTTATCGC
 
. : . : . : . : . : . :
JMSF022A23+ TTGCATCTTTAACACCAGCGGGGACATGGTTGAGGGCGATGCCGGTGCTATTGAGGGCCT
JMFS145D07+ TTGCATCTTTAACACCAGCGGGGACATGGTTGAGGGCGATGCCGGTGCTATTGAGGGCCT
JMFS024C04+ TTGCATCTTTAACACCAGCGGGGACATGGTTGAGGGCGATGCCGGTGCTATTGAGGGCCT
JMFS080D02+ TTGCATCTTTAACACCAGCGGGGACATGGTTGAGGGCGATGCCGGTGCTATTGAGGGCCT
                      ____________________________________________________________
consensus TTGCATCTTTAACACCAGCGGGGACATGGTTGAGGGCGATGCCGGTGCTATTGAGGGCCT
 
. : . : . : . : . : . :
JMSF022A23+ GCTGAACCGACGGCGAGATCTTGGTAGTATCCCCGTAGGCGGAGATGGAGACGGGGCCGC
JMFS145D07+ GCTGAACCGACGGCGAGATCTTGGTAGTATCCCCGTAGGCGGAGATGGAGACGGGGCCGC
JMFS024C04+ GCTGAACCGACGGCGAGATCTTGGTAGTATCCCCGTAGGCGGAGATGGAGACGGGGCCGC
JMFS080D02+ GCTGAACCGACGGCGAGATCTTGGTAGTATCCCCGTAGGCGGAGATGGAGACGGGGCCGC
                      ____________________________________________________________
consensus GCTGAACCGACGGCGAGATCTTGGTAGTATCCCCGTAGGCGGAGATGGAGACGGGGCCGC
 
. : . : . : . : . : . :
JMSF022A23+ AGTAGTTCAATTTGACCAACGCCGAGCTAATATTCTGCGCGATCGC
JMFS145D07+ AGTAGTTCAATTTGACCAACGCCGAGCTAATATTCTGCGCGATCGCGTGCGGATCGGAGC
JMFS024C04+ AGTAGTTCAATTTGACCAACGCCGAGCTAATATTCTGCGCGATCGCGTGCGGATCGGAGC
JMFS080D02+ AGTAGTTCAATTTGACCAACGCCGAGCTAATATTCTGCGCGATCGCGTGCGGATCGGAGC
                      ____________________________________________________________
consensus AGTAGTTCAATTTGACCAACGCCGAGCTAATATTCTGCGCGATCGCGTGCGGATCGGAGC
 
. : . : . : . : . : . :
JMFS145D07+ CCCTGGGCACCTGGCAGTTCTCTATGTCCCACCACACCGATATCCTCGCTCCCGAATATA
JMFS024C04+ CCCTGGGCACCTGGCAGTTCTCTATGTCCCACCACACCGATATCCTCGCTCCCGAATATA
JMFS080D02+ CCCTGGGCACCTGGCAGTTCTCTATGTCCCACCACACCGATATCCTCGCTCCCGAATATA
                      ____________________________________________________________
consensus CCCTGGGCACCTGGCAGTTCTCTATGTCCCACCACACCGATATCCTCGCTCCCGAATATA
 
. : . : . : . : . : . :
JMFS145D07+ GCGCCTCCGCCGCTTCCGACGGCTGCTGCATCGCCAACGCTCCTCCACCTACTGCTCCGT
JMFS024C04+ GCGCCTCCGCCGCTTCCGACGGCTGCTGCATCGCCAACGCTCCTCCACCTACTGCTCCGT
JMFS080D02+ GCGCCTCCGCCGCTTCCGACGGCTGCTGCATCGCCAACGCTCCTCCACCTACTGCTCCGT
                      ____________________________________________________________
consensus GCGCCTCCGCCGCTTCCGACGGCTGCTGCATCGCCAACGCTCCTCCACCTACTGCTCCGT
 
. : . : . : . : . : . :
JMFS145D07+ TCCCGCCCGCTCCACCCATGGATAACGACGATCGCCGCAAAAGGAAAGTCGGAAAGTATA
JMFS024C04+ TCCCGCCCGCTCCACCCATGGATAACGACGATCGCCGCAAAAGGAAAGTCGGAAAGTATA
JMFS080D02+ TCCCGCCCGCTCCACCCATGGATAACGACGATCGCCGCAAAAGGAAAGTCGGAAAGTATA
                      ____________________________________________________________
consensus TCCCGCCCGCTCCACCCATGGATAACGACGATCGCCGCAAAAGGAAAGTCGGAAAGTATA
 
. : . : . : . : . : . :
JMFS145D07+ GTGGCTACGACTTTAGATTGTCGGAAATGGCGCACGATAGCAAGCAAGCACAGCTGTGAA
JMFS024C04+ GTGGCTACGACTTTAGATTGTCGGAAATGGCGCACGATAGCAAGCAAGCACAGCTGT-AA
JMFS080D02+ GTGGCTACGACTTTAGATTGTCGGAAATGGCGCACGATAGCAAGCAAGCACAGCTGTGAA
                      ____________________________________________________________
consensus GTGGCTACGACTTTAGATTGTCGGAAATGGCGCACGATAGCAAGCAAGCACAGCTGTGAA
 
. : . : . : . : . : . :
JMFS145D07+ GCTTCTAGATTATC
JMFS024C04+ GCTTCTAGATTATCCTAGTTCGCTAATTTG
JMFS080D02+ GCTTCTAGATTATCCTAGTTCGCTAATTTGTTGGTTTTCAGCGGGCGGAGCCTAAAATAG
                      ____________________________________________________________
consensus GCTTCTAGATTATCCTAGTTCGCTAATTTGTTGGTTTTCAGCGGGCGGAGCCTAAAATAG