Previous Contig 003517:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038L21Sequence570003517 (2)gb:AP003236_18259352e-49Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P004
JMFS079D01Sequence624003517 (2)gb:AP003236_18259359e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P004

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF038L21+ TGATT
JMFS079D01+ CTCGACAACCATCTCACCATGATT
                      ____________________________________________________________
consensus CTCGACAACCATCTCACCATGATT
 
. : . : . : . : . : . :
JMFF038L21+ TTATGGTTTAACCNCCTTTTCACCAACTCTCTTAGCATAAATTCATCATGCTTCTCTCTC
JMFS079D01+ TTATGGTTTAACCACCTTTTCACCAACTCTCTTAGCATAAATTCATCATGCTTCTCTCTC
                      ____________________________________________________________
consensus TTATGGTTTAACCACCTTTTCACCAACTCTCTTAGCATAAATTCATCATGCTTCTCTCTC
 
. : . : . : . : . : . :
JMFF038L21+ AAAGAAGGCAACACCGTTAATGTGATGTATTCCTCAAAGGACTCCCGGTATTTGTCATAT
JMFS079D01+ AAAGAAGGCAACACCGTTAATGTGATGTATTCCTCAAAGGACTCCCGGTATTTGTCATAT
                      ____________________________________________________________
consensus AAAGAAGGCAACACCGTTAATGTGATGTATTCCTCAAAGGACTCCCGGTATTTGTCATAT
 
. : . : . : . : . : . :
JMFF038L21+ AACTGCTGAGAATAATCATGGGGCGGTTTTTGTGTGCACATATTGTAAATTGTAGTGTAC
JMFS079D01+ AACTGCTGAGAATAATCATGGGGCGGTTTTTGTGTGCACATATTGTAAATTGTAGTGTAC
                      ____________________________________________________________
consensus AACTGCTGAGAATAATCATGGGGCGGTTTTTGTGTGCACATATTGTAAATTGTAGTGTAC
 
. : . : . : . : . : . :
JMFF038L21+ AACATCATATAATCCTCAGAGCTGAACTGTGGCTCTGGCAACCCTTCCAGAATGTTCTTC
JMFS079D01+ AACATCATATAATCCTCAGAGCTGAACTGTGGCTCTGGCAACCCTTCCAGAATGTTCTTC
                      ____________________________________________________________
consensus AACATCATATAATCCTCAGAGCTGAACTGTGGCTCTGGCAACCCTTCCAGAATGTTCTTC
 
. : . : . : . : . : . :
JMFF038L21+ AGCTTTGTTATCCCCCGCTGCATGAAGTCCCATCCCTGTTCTAAATCAATTGTGCTGCGC
JMFS079D01+ AGCTTTGTTATCCCCCGCTGCATGAAGTCCCATCCCTGTTCTAAATCAATTGTGCTGCGC
                      ____________________________________________________________
consensus AGCTTTGTTATCCCCCGCTGCATGAAGTCCCATCCCTGTTCTAAATCAATTGTGCTGCGC
 
. : . : . : . : . : . :
JMFF038L21+ TGATTCATTGACATTATGATACCTCCAAACTTCAAATTTTAGTGCACACAGCTATTCGTC
JMFS079D01+ TGATTCATTGACATTATGATACCTCCAAACTTCAAATTTTAGTGCACACAGCTATTCGTC
                      ____________________________________________________________
consensus TGATTCATTGACATTATGATACCTCCAAACTTCAAATTTTAGTGCACACAGCTATTCGTC
 
. : . : . : . : . : . :
JMFF038L21+ TATTCCAGTTCCAAATTGGAGGAAGAACAGCACCAAATAAAAATCTGGTTTATCGAGTGT
JMFS079D01+ TATTCCAGTTCCAAATTGGAGGAAGAACAGCACCAAATAAAAATCTGGTTTATCGAGTGT
                      ____________________________________________________________
consensus TATTCCAGTTCCAAATTGGAGGAAGAACAGCACCAAATAAAAATCTGGTTTATCGAGTGT
 
. : . : . : . : . : . :
JMFF038L21+ CAAAACCACAATCAACTTTTCAGTCCAGATAAGACGAAGTAAAGTTAGAGCTCAGAACTT
JMFS079D01+ CAAAACCACAATCAACTTTTCAGTCCAGATAAGACGAAGTAAAGTTAGAGCTCAGAACTT
                      ____________________________________________________________
consensus CAAAACCACAATCAACTTTTCAGTCCAGATAAGACGAAGTAAAGTTAGAGCTCAGAACTT
 
. : . : . : . : . : . :
JMFF038L21+ CCGCAAATCGAAGCCAAAAAAATATTCT
JMFS079D01+ CCGCAAATCGAAGCCAAAAAAATATTCTATCCGAGTAAGTGTTAGTAAAGGTAAAGAGCT
                      ____________________________________________________________
consensus CCGCAAATCGAAGCCAAAAAAATATTCTATCCGAGTAAGTGTTAGTAAAGGTAAAGAGCT
 
. : . : . : . : . : . :
JMFS079D01+ TGCTGGGAAAGCGATCGGAGCTCCGTGGAGGATCTCGACAGAAAGGGGAGGGAGAAAGGA
                      ____________________________________________________________
consensus TGCTGGGAAAGCGATCGGAGCTCCGTGGAGGATCTCGACAGAAAGGGGAGGGAGAAAGGA