Previous Contig 003508:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN019P18Sequence619003508 (2)gb:AY700673_16236078e-91Helianthus tuberosus putative dicarboxylate/tricarboxylate carrier mRNA, partial
JMFS077H11Sequence634003508 (2)gb:NTA311777_1691339e-100Nicotiana tabacum partial mRNA for mitochondrial dicarboxylate/tricarboxylate ca

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN019P18+ ACATGAGGAGCAATT
                      ____________________________________________________________
consensus ACATGAGGAGCAATT
 
. : . : . : . : . : . :
JMFN019P18+ CTAACACAGTATACGGGGAATCCAGTGTAAACTTAAAAGGCCCTCCCGCCTTGAGGGTTT
                      ____________________________________________________________
consensus CTAACACAGTATACGGGGAATCCAGTGTAAACTTAAAAGGCCCTCCCGCCTTGAGGGTTT
 
. : . : . : . : . : . :
JMFN019P18+ GCATAGCACAGTCAACGGAACCGGTGTAGGGATATTTCCCAGCGGCATCTGGTTGCATCT
                      ____________________________________________________________
consensus GCATAGCACAGTCAACGGAACCGGTGTAGGGATATTTCCCAGCGGCATCTGGTTGCATCT
 
. : . : . : . : . : . :
JMFN019P18+ TCTGGATTTGTGTCTTCACGTAGTCAAACGGTAAGCTGCAAGCAGCAGCGAAGAATCCGG
                      ____________________________________________________________
consensus TCTGGATTTGTGTCTTCACGTAGTCAAACGGTAAGCTGCAAGCAGCAGCGAAGAATCCGG
 
. : . : . : . : . : . :
JMFN019P18+ ATACTGCACTAGCCCCTACAACTGTGGCAGTCTCTCCCATGCCAAGAGAATCCCGACAAA
JMFS077H11+ CCCATGCCAAGAGAATCCCGACAAA
                      ____________________________________________________________
consensus ATACTGCACTAGCCCCTACAACTGTGGCAGTCTCTCCCATGCCAAGAGAATCCCGACAAA
 
. : . : . : . : . : . :
JMFN019P18+ ACTCAACACTTTGGTCATAAGAGGCGAGCATTCCCATGTTAAGCGCCATTGCCCTCACTA
JMFS077H11+ ACTCAACACTTTGGTCATAAGAGGCGAGCATTCCCATGTTAAGCGCCATTGCCCTCACTA
                      ____________________________________________________________
consensus ACTCAACACTTTGGTCATAAGAGGCGAGCATTCCCATGTTAAGCGCCATTGCCCTCACTA
 
. : . : . : . : . : . :
JMFN019P18+ CAGTCGGGCCAGCGCCCTTCCAAAGGGCTAAAACTCCTTCATCAGCAACAATGCGGGACA
JMFS077H11+ CAGTCGGGCCAGCGCCCTTCCAAAGGGCTAAAACTCCTTCATCAGCAACAATGCGGGACA
                      ____________________________________________________________
consensus CAGTCGGGCCAGCGCCCTTCCAAAGGGCTAAAACTCCTTCATCAGCAACAATGCGGGACA
 
. : . : . : . : . : . :
JMFN019P18+ GCGCATGGAAGGCATTTGTGTAGTTACGTCGCTGGGCGGCGGGTAAGGTGGCATCCGCCT
JMFS077H11+ GCGCATGGAAGGCATTTGTGTAGTTACGTCGCTGGGCGGCGGGTAAGGTGGCATCCGCCT
                      ____________________________________________________________
consensus GCGCATGGAAGGCATTTGTGTAGTTACGTCGCTGGGCGGCGGGTAAGGTGGCATCCGCCT
 
. : . : . : . : . : . :
JMFN019P18+ GCATACGGATGAGTGCCAAATCAGCGGGACTGCCCACACAGGCTCCAATCGCCCCCGCAG
JMFS077H11+ GCATACGGATGAGTGCCAAATCAGCGGGACTGCCCACACAGGCTCCAATCGCCCCCGCAG
                      ____________________________________________________________
consensus GCATACGGATGAGTGCCAAATCAGCGGGACTGCCCACACAGGCTCCAATCGCCCCCGCAG
 
. : . : . : . : . : . :
JMFN019P18+ TCAGCCCACACAGCGCCTTCTGATATAGAGGCAATGGCTTCCCGTCATTGGCTTCAATAG
JMFS077H11+ TCAGCCCACACAGCGCCTTCTGATATAGAGGCAATGGCTTCCCGTCATTGGCTTCAATAG
                      ____________________________________________________________
consensus TCAGCCCACACAGCGCCTTCTGATATAGAGGCAATGGCTTCCCGTCATTGGCTTCAATAG
 
. : . : . : . : . : . :
JMFN019P18+ CCTTGGTCGTCAAAATTCTGAATGATCCAAGACGGGCAGTTGTATAAGTAGCCTGTCTAA
JMFS077H11+ CCTTGGTCGTCAAAATTCTGAATGATCCAAGACGGGCAGTTGTATAAGTAGCCTGTCTAA
                      ____________________________________________________________
consensus CCTTGGTCGTCAAAATTCTGAATGATCCAAGACGGGCAGTTGTATAAGTAGCCTGTCTAA
 
. : . : . : . : . : . :
JMFN019P18+ G
JMFS077H11+ GAAGCCCAGCAGACAAACCCTTGTAAAAGGCACCAAAGCCCTCATTTTTAAGCATATTCT
                      ____________________________________________________________
consensus GAAGCCCAGCAGACAAACCCTTGTAAAAGGCACCAAAGCCCTCATTTTTAAGCATATTCT
 
. : . : . : . : . : . :
JMFS077H11+ TGGTGACCTCGCCAGCTGATCCCTGGCCCAATTGGATTCTCACCTTGACCATGTCGATGG
                      ____________________________________________________________
consensus TGGTGACCTCGCCAGCTGATCCCTGGCCCAATTGGATTCTCACCTTGACCATGTCGATGG
 
. : . : . : . : . : . :
JMFS077H11+ GTTGAATGACGCAGGTGGCGAGCATGCCGGAGCAACCGCCATTAACAAAGGGCTTCACGG
                      ____________________________________________________________
consensus GTTGAATGACGCAGGTGGCGAGCATGCCGGAGCAACCGCCATTAACAAAGGGCTTCACGG
 
. : . : . : . : . : . :
JMFS077H11+ TGGGCCAGACGGCGGCGACGGGCTTGGGCTTCTCCTCTCCCATTCTTCCTGAGATTCCAA
                      ____________________________________________________________
consensus TGGGCCAGACGGCGGCGACGGGCTTGGGCTTCTCCTCTCCCATTCTTCCTGAGATTCCAA