Previous Contig 003504:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018G17Sequence555003504 (11)gb:AY127028_15804815e-29Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A787009064 (2)gb:AY127028_15804813e-30Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS013E11Sequence618003504 (11)gb:AY127028_15804816e-93Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS057H04Sequence627003504 (11)gb:AY127028_15804811e-52Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS065E08Sequence592003504 (11)gb:AY127028_15804811e-21Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS076H03Sequence615003504 (11)gb:AY127028_15804819e-36Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS077B02Sequence638003504 (11)gb:AY127028_15804818e-57Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS091D04Sequence618003504 (11)gb:AY127028_15804812e-44Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS108A02Sequence628003504 (11)gb:AY127028_15804811e-50Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS112B06Sequence627003504 (11)gb:AY127028_15804812e-45Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMFS112B07Sequence627003504 (11)gb:AY127028_15804819e-45Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A
JMSF020G08Sequence679003504 (11)gb:AY127028_15804817e-51Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A801009064 (2)gb:AY127028_15804814e-30Arabidopsis thaliana At1g07990/T6D22_5 mRNA, complete cds.>gb:BT004535_1637569 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS013E11+ CATGACCAAATACTCTAGAAATAAAACTTGGGCTAGATAACTTAGTAG
                      ____________________________________________________________
consensus CATGACCAAATACTCTAGAAATAAAACTTGGGCTAGATAACTTAGTAG
 
. : . : . : . : . : . :
JMFS013E11+ CAAGAGGGGATGGTGAATTTCTGGTAATTGAGCAGAGTGTTTCAGCAGCATTAGCATGCA
                      ____________________________________________________________
consensus CAAGAGGGGATGGTGAATTTCTGGTAATTGAGCAGAGTGTTTCAGCAGCATTAGCATGCA
 
. : . : . : . : . : . :
JMFS013E11+ CTTCGGGAGGACTAGAAGGGCTTAATTTATCAACAATCATTTCCAATAAATTACTATCAG
                      ____________________________________________________________
consensus CTTCGGGAGGACTAGAAGGGCTTAATTTATCAACAATCATTTCCAATAAATTACTATCAG
 
. : . : . : . : . : . :
JMFS013E11+ CCAACCATTGCATGACATCTAAGGAATTGGTATAGATATGATCGTCAGCGCCTACAAGAC
                      ____________________________________________________________
consensus CCAACCATTGCATGACATCTAAGGAATTGGTATAGATATGATCGTCAGCGCCTACAAGAC
 
. : . : . : . : . : . :
JMFS013E11+ GGACCAAAACCTCCATGATGGATGTAATACCAATCAAATCAACCATCTGTTGAAAAACAT
                      ____________________________________________________________
consensus GGACCAAAACCTCCATGATGGATGTAATACCAATCAAATCAACCATCTGTTGAAAAACAT
 
. : . : . : . : . : . :
JMFS013E11+ CAGGATGGGCCTGAACATAGTTCATAAGTTGAATGGTCTTCCGCATCATGAGGCATATAA
JMFS077B02+ CATATAA
                      ____________________________________________________________
consensus CAGGATGGGCCTGAACATAGTTCATAAGTTGAATGGTCTTCCGCATCATGAGGCATATAA
 
. : . : . : . : . : . :
JMFS013E11+ CAACCTTGCTAAAATATCCAGCCAACAAGGCGCTATGAGGACGACTTGCTTCCAAGAAGG
JMFS077B02+ CAACCTTGCTAAAATATCCAGCCAACAAGGCGCTATGAGGACGACTTGCTTCCAAGAAGG
JMFS057H04+ TTGCTAAAATATCCAGCCAACAAGGCGCTATGAGGACGACTTGCTTCCAAGAAGG
JMSF020G08+ AATATCCAGCCANCAAGGCGCTATGAGGACGACTTGCTTCCAAGAAGG
JMFS108A02+ TATCCAGCCAACAAGGCGCTATGAGGACGACTTGCTTCCAAGAAGG
JMFS112B07+ CGACTTGCTTCCAAGAAGG
JMFS112B06+ CGACTTGCTTCCAAGAAGG
JMFS091D04+ AAGAAGG
                      ____________________________________________________________
consensus CAACCTTGCTAAAATATCCAGCCAACAAGGCGCTATGAGGACGACTTGCTTCCAAGAAGG
 
. : . : . : . : . : . :
JMFS013E11+ AAAATAATAAATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
JMFS077B02+ AAAATAATAAATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
JMFS065E08+ ACTCTTCCTCCGCCACCAGAGTCTTAAGGATAACATCAATTT
JMFS057H04+ AAAATAATAAATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
JMSF020G08+ AAAATAATAAATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
JMFS108A02+ AAAATAATAAATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
JMFS112B07+ AAAATAATANATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
JMFS112B06+ AAAATAATAAATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
JMFS091D04+ AAAATAATAAATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
JMFS076H03+ TAAGGATAACATCAATTT
                      ____________________________________________________________
consensus AAAATAATAAATTCATTAACTCTTCCTCCTCCACCAAAGTCTTAAGGATAACATCAATTT
 
. : . : . : . : . : . :
JMFS013E11+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMFS077B02+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMFS065E08+ AGCATGTGCATATCTCACATGCAATGAAAGGACCCTTGAATGTCCGTTGCTTATCTATGA
JMFS057H04+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMSF020G08+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMFS108A02+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMFS112B07+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMFS112B06+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMFS091D04+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMFF018G17+ CACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
JMFS076H03+ CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
                      ____________________________________________________________
consensus CGCATGTGAATATCTCACATGCAATGAAAGGAAACTTGAATGTCCGTTTGTTATCTAT-A
 
. : . : . : . : . : . :
JMFS013E11+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMFS077B02+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMFS065E08+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCCACTTGTGCTCTATCCCTC
JMFS057H04+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMSF020G08+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMFS108A02+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMFS112B07+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMFS112B06+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMFS091D04+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMFF018G17+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
JMFS076H03+ TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
                      ____________________________________________________________
consensus TCACTGGAAGGCTCTTCAATAACATAACGCAGTAACTGTTCAACCTGTGCTCTATCCCTC
 
. : . : . : . : . : . :
JMFS013E11+ AAAAAATTTATGAGGCGACTATTCAAAGCTT
JMFS077B02+ AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
JMFS065E08+ ACAGAATGTATGAGGCGACTATTCATAGCTATGCATTATTGGAGGATCTCCTATTCATCA
JMFS057H04+ AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
JMSF020G08+ AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
JMFS108A02+ AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
JMFS112B07+ AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
JMFS112B06+ AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
JMFS091D04+ AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
JMFF018G17+ AAAAAATTTATGAGGCGACTATTCAAAGATTTGCATTCTTGGATTATCTCCTCTTCATCA
JMFS076H03+ AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
                      ____________________________________________________________
consensus AAAAAATTTATGAGGCGACTATTCAAAGCTTTGCATTCTTGGATTATCTCCTCTTCATCA
 
. : . : . : . : . : . :
JMFS077B02+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
JMFS065E08+ AGGAGCTCGTCCAGAGTGACATTTTCCTTGTCCAATATGGCTTCGAGCGCAAGAGAAGCC
JMFS057H04+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
JMSF020G08+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
JMFS108A02+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
JMFS112B07+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
JMFS112B06+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
JMFS091D04+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
JMFF018G17+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
JMFS076H03+ AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
                      ____________________________________________________________
consensus AGAAGCTCTTCCAGAGTGAAATTTTCCTTGTCCAATATGGCTTCGACCGGCGAAGAAGCC
 
. : . : . : . : . : . :
JMFS077B02+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
JMFS065E08+ GAGAGTGGTGTCAGCTTTCATAACATATCTCGAATGCGCGTCCTCGGCTATAGATACAGA
JMFS057H04+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
JMSF020G08+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
JMFS108A02+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
JMFS112B07+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
JMFS112B06+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
JMFS091D04+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
JMFF018G17+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
JMFS076H03+ GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
                      ____________________________________________________________
consensus GAGAGTGGTGTCAGCTTCCAAAACATATCTCGAATGCGCGTCCGCGGCTATAGATACAGA
 
. : . : . : . : . : . :
JMFS077B02+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
JMFS065E08+ TATAGGTATGTAAGCGGTAAGAGATGAAGACGATCGGCGAGTGTGAAGGATGGACCGACC
JMFS057H04+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
JMSF020G08+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
JMFS108A02+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
JMFS112B07+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
JMFS112B06+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
JMFS091D04+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
JMFF018G17+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
JMFS076H03+ TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
                      ____________________________________________________________
consensus TATAGGTATGTAAACGGTGAGAGATGAAGACGAGCGGCGAG-CTGAAGGCTGGAGCGAAC
 
. : . : . : . : . : . :
JMFS077B02+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
JMFS065E08+ TAGTAAACGAGATCTGTGGTCCCTAAAGTTGAATCT
JMFS057H04+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
JMSF020G08+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
JMFS108A02+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
JMFS112B07+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
JMFS112B06+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
JMFS091D04+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
JMFF018G17+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
JMFS076H03+ TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
                      ____________________________________________________________
consensus TAGAAAACTAGATCTGTAAACCCTAAAGTTGAATCTCGGACATGAGAGGCCGAGATTTGA
 
. : . : . : . : . : . :
JMFS077B02+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
JMFS057H04+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
JMSF020G08+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
JMFS108A02+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
JMFS112B07+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
JMFS112B06+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
JMFS091D04+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
JMFF018G17+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
JMFS076H03+ GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
                      ____________________________________________________________
consensus GGTGAGGATAGACGTAGGGCTTTAGGCAGAGACAGCAAAAACCCTAAAATTTTGACGAAG
 
. : . : . : . : . : . :
JMFS077B02+ AAGAAGAAGAAAAGGATCAAA
JMFS057H04+ AAGAAGAAAAAAAGGATCAAACGAGAGCAAAGCC
JMSF020G08+ AAGAAGAAGAAAAGGATCAAACGAGAGCAAAGCCGC
JMFS108A02+ AAGAAGAAGAAAAGGATCAAACGAGAGCAAAGCCGCCAGGCCAG
JMFS112B07+ AAGAAGAAGAAAAGGATCAAACGAGAGCAAAGCCGCCAGGCCAGGACCGAAAGGTTAGAG
JMFS112B06+ AAGAAGAAGAAAAGGATCAAACGAGAGCAAAGCCGCCAGGCCAGGACCGAAAGGTTAGAG
JMFS091D04+ AAGAAGAAGAAAAGGATCAAACGAGAGCAAAGCCGCCAGGCCAGGACCGAAAGGTTAGAG
JMFF018G17+ AAGAAGAAGAAAAGGATCAAACGAGAGCAAAGCCGC
JMFS076H03+ AAGAAGAAGAAAAGGATCAAACGAGAGCAAAGCCGCTGTACGCAGACC-TAGTTTTGGGA
                      ____________________________________________________________
consensus AAGAAGAAGAAAAGGATCAAACGAGAGCAAAGCCGCCAGGCCAGGACCGAAAGGTTAGAG
 
. : . : . : . : . : . :
JMFS112B07+ ATGTGTTTTT
JMFS112B06+ ATGTGTTTTT
JMFS091D04+ ATGTGTTTTT
JMFS076H03+ ACGAGGATGAAGGAATTTGCCATAGCTGTAACAGACTCATTCCCTTTCTTCACTAAGCAC
                      ____________________________________________________________
consensus ATGTGTTTTTAGGAATTTGCCATAGCTGTAACAGACTCATTCCCTTTCTTCACTAAGCAC